5-HT1A⁺Treg cells and their associated signaling pathways may be the key mediators determining susceptibility in mouse models of depression^z,2

Yan-bo Wang 1,2

Li-Jun Liu 1

Xiao-chun Zhang 1

Bin-bin Bai 3

Rui Jing 1

Yuan Hu 1✉ Emailhuyuan1980619@126.com

w 1

1 Department of Pharmacy, Medical Supplier Center Chinese PLA General Hospital 100853 Beijing China

2 Graduate School of PLA General Hospital 100853 Beijing China

3 Unit 32026 of the Chinese People’s Liberation Army 475000 Kaifeng China

Yan-bo Wang^y,3,x,4· Li-Jun Liu¹· Xiao-chun Zhang^1,2· Bin-bin Bai^w,5·· Rui Jing¹· Yuan Hu¹

^z,2 Yuan Hu

huyuan1980619@126.com

^y,3 Department of Pharmacy, Medical Supplier Center, Chinese PLA General Hospital, Beijing 100853, China

^x,4 Graduate School of PLA General Hospital, Beijing 100853, China

^w,5 Unit 32026 of the Chinese People's Liberation Army, Kaifeng 475000, China

Abstract

Rationale

Chronic social defeat stress (CSDS) can naturally distinguish between susceptible and resistant individuals, and in-depth exploration of its specific mechanisms holds significant potential value for the prevention and treatment of depression.

Objective

To investigate the key molecular biological mechanisms and signaling pathways that determine susceptibility versus resilience in the CSDS mouse model.

Method

Adolescent C57BL/6J mice were exposed to CD-1 mouse cages for 10 consecutive days to establish the CSDS model. After distinguishing between susceptible and resilient mice, behavioral indicators were validated in each group. Differentially expressed proteins and pathways were screened using Olink Proteomics technology and the Kyoto Encyclopedia of Genes and Genomes (KEGG). The expression of key cytokine mRNAs, including Il17a, Ifng, and Il4, in the in vitro co-culture system of regulatory T cells (Treg) and microglia was detected using reverse transcription quantitative polymerase chain reaction (RT-qPCR).

Result

(1) Significant differences in behavioral indicators were observed between the susceptible group and the control group. (2) Olink and KEGG enrichment analyses identified 4 common differentially expressed proteins (EBI3_IL27, LRIG1, NAGK, SPN) and 2 shared pathways (hsa04060 and hsa04657). (3) Co-culture experiments demonstrated that WAY100635 could block 5-HT-induced downregulation of Il17a and Ifng mRNA expression, as well as upregulation of Il4 mRNA.

Conclusion

In the CSDS model, 5-HT1A⁺Treg cells and their associated cytokine pathways may be the key mediators determining susceptibility to stress.

Key words

Depression

Chronic social defeat stress

Susceptibility

Resilience

Treg cells

1.Introduction

Depression, as a highly prevalent mental disorder worldwide, poses a serious threat to human physical and mental health. Clinical research and epidemiological evidence consistently indicate that chronic stress is a core trigger for the onset of depression. Prolonged psychosocial stress (such as life setbacks or social adversity) can lead to long-term alterations in the immune system, ultimately inducing depression-like phenotypes(Feng et al. 2025; Kokkosis et al. 2024). In recent years, the role of immune-inflammatory mechanisms in depression pathogenesis has garnered significant attention. Numerous studies have confirmed that individuals with depression and those under stress exhibit abnormalities in adaptive immune cells(Daray et al. 2024), elevated acute-phase proteins(Suneson et al. 2023), and increased levels of pro-inflammatory cytokines(Sørensen et al. 2023). These factors further contribute to disease progression by disrupting the blood-brain barrier(Matsuno et al. 2022), activating microglia(Afridi et al. 2023), and impairing neuroplasticity(Muhammad et al. 2021). However, not all chronic stress ultimately leads to depression, as its pathogenesis remains complex and exhibits individual variability, which imposes higher demands on the validity of preclinical research models. The CSDS model has emerged as an ideal tool for investigating depression mechanisms due to its unique advantages. This model not only accurately replicates core behavioral phenotypes of depression such as anhedonia and social avoidance by simulating chronic social conflict scenarios in humans—demonstrating high consistency with clinical disease progression—but also naturally presents clear distinctions between stress-susceptible and resilient subgroups. This provides a unique perspective for elucidating the molecular mechanisms underlying individual differences in stress tolerance and screening potential disease susceptibility biomarkers.

As one of the core inhibitory receptors in the serotonergic system, the 5-HT1A receptor serves as a key target mediating 5-HT's regulation of central neuroimmunity(Warren et al. 2025). Studies have confirmed that the activity of 5-HT1A receptors in the intermediate lateral septal zone (LSi) directly regulates stress susceptibility in mice(Zhou et al. 2024). Microglia are the primary innate immune cells in the brain and act as initiators of neuroinflammation. Treg cells, as core peripheral adaptive immune cells, can become activated and cross the blood-brain barrier to infiltrate the central nervous system under depressive states, jointly regulating brain inflammation levels alongside microglia. As a highly specific antagonist of the 5-HT1A receptor, WAY100635 can specifically block the activation effects of this receptor, serving as a classic pharmacological tool for verifying the 5-HT1A receptor-mediated neuro-immune regulatory function.

In this experiment, a CSDS model was constructed to distinguish susceptible mice through social interaction tests. Olink proteomics and KEGG enrichment analysis were employed to identify key differential proteins and pathways in susceptible mice. Additionally, an in vitro co-culture system of Treg cells and microglia was established, where changes in Il17a, Ifng, and Il4 mRNA levels were measured by RT-qPCR to investigate the molecular mechanisms underlying susceptibility in mice.

2. Materials and methods

2.1. Animals

C57BL/6J wild-type (WT) mice (male, 5 weeks old, n = 42, body weight 22–25 g) and CD-1 wild-type mice (male, 8 weeks old, n = 50, body weight 36–40 g) were provided by Sibeifu (Beijing) Biotechnology Co., Ltd. [SCXK (Jing) 2024-0001]. The mice were housed in the SPF-grade animal facility of Sibeifu (Beijing) Biotechnology Co., Ltd., under controlled environmental conditions (temperature 23 ± 2°C, humidity 60 ± 10%, 12h light/dark cycle), with free access to food and water during the experimental period.

All animal experiments were approved by the Animal Experiment Ethics Committee of the General Hospital of the People's Liberation Army (Approval No. 2023-X19-123).

2.2. Drugs and reagents

5-HT (HY-B1473A), WAY-100635 maleate (HY-10349A), and TNF-α (HY-P7090) were all purchased from MedChemExpress; Mouse CD4⁺CD25⁺ Regulatory T Cell Isolation Kit II (18783) and Mouse CD11b Positive Selection Kit II (18970) were purchased from STEMCELL; Mouse IL-2 Recombinant Protein (Gibco, 212-12-5UG); Papain (Solarbio, P8150); DNase I (Biosharp, BS137).

2.3 Establishment and screening of the CSDS model

After screening aggressive CD-1 mice for 3 consecutive days, they were housed individually. The social defeat stress procedure lasted for 10 days, during which each C57BL/6J mouse (defeated mouse) was placed into the cage of an unfamiliar CD-1 mouse (aggressor) for 10 minutes daily (with controlled attack intensity). Subsequently, they were separated within the same cage using a perforated transparent plastic divider, maintaining 24-hour sensory contact (visual, olfactory, and auditory but without physical contact). The aggressive CD-1 mice were replaced daily to prevent habituation and maximize psychological stress (Fig. 1A).

2.4 Social Interaction Test

Place the experimental C57BL/6J mice in the test cage for 5–10 minutes of acclimation, followed by baseline measurements. Subsequently, introduce an aggressive CD-1 mouse into a small cage and record the time and frequency of the experimental C57BL/6J mice approaching and contacting the small cage for 2.5 minutes. The social interaction ratio (SI ratio) is calculated by dividing the time (T) spent by C57BL/6J mice in the interaction zone when the CD-1 mouse is present by the time (T0) spent in the interaction zone when the CD-1 mouse is absent. An SI ratio of 1 serves as the threshold for distinguishing susceptible mice from resistant mice, with T/T0 < 1.0 classified as the susceptible group and T/T0 ≥ 1.0 as the resistant group.

2.5 Open Field Test

Place the mouse in the center of a dark open-field apparatus divided into 16 equal-area squares at the bottom. Record the mouse's activity for 6 minutes using a camera, with the first 2 minutes serving as an adaptation period. Count the horizontal and vertical activities between minutes 3–6. A horizontal activity is recorded when all four paws of the mouse enter a new square. After each test, clean the apparatus with alcohol to eliminate residual odors or feces that might affect subsequent mice.

2.6 Sucrose Preference Test

Mice were provided with two bottles of 2% sucrose solution for 24 hours, followed by replacement of one bottle with pure water for another 24-hour adaptation period. After 12 hours, the positions of the bottles were switched. Following 24 hours of fasting and water deprivation, pre-weighed bottles containing pure water and 2% sucrose solution were given for a 1-hour formal test, and the remaining weights of both liquids were recorded. The preference value was calculated using the formula: Sucrose preference (%) = Sucrose consumption / (Sucrose consumption + Water consumption)×100%.

2.7 Forced Swim Test

Place the mice into transparent cylindrical containers (35 cm in height, 11 cm in diameter) filled with water at 23 ± 1°C to a depth of 25 cm. Each container is separated by black baffles to prevent mutual interference. Record for 6 minutes, with the first 2 minutes as adaptation time. Analyze the immobility time during minutes 3–6, defined as when the mouse actively gives up struggling and remains floating. After each test, dry the mouse with a towel before returning it to the cage. Replace the water in the container before testing the next mouse to avoid experimental errors.

2.8 Olink proteomics

After sorting Tregs according to the CD4⁺CD25⁺Treg magnetic bead sorting kit instructions and activating them, they were mixed at a 1:1 ratio (5×10⁵ cells per well each) with primary microglia sorted using the CD11b positive selection kit II for co-culture. The cells were divided into three treatment groups: the control group received an equal volume of PBS; the 5-HT group received 8.3nM/mL 5-HT; and the 5-HT + SB group received 8.3nM/mL 5-HT + 200ng/mL SB269970. The co-culture was maintained in a 37℃, 5% CO₂ incubator. After 72 hours of co-culture, the cells were collected for detection.

2.9 RT- qPCR

Table 1

Primer sequence list
Target genes	Forward Primer (5′-3′)	Reverse Primer (5′-3′)
β-actin	GTGACGTTGACATCCGTAAAGA	GTAACAGTCCGCCTAGAAGCAC
Ifng	GAGGTCAACAACCCACAGGT	GGGACAATCTCTTCCCCACC
il4	AAACTCCATGCTTGAAGAAGAACTC	TGATGCTCTTTAGGCTTTCCAG
Il17a	CTGTGTCTCTGATGCTGTTGCTG	CGTGGAACGGTTGAGGTAGTC

After washing twice with PBS, cells were fully lysed with Trizol. Total RNA was obtained through chloroform extraction, isopropanol precipitation, washing with 75% RNase-free ethanol, and dissolution in RNase-free water. RNA purity (A260/A280 ≈ 1.8–2.0) and concentration were measured using Nanodrop. A quantified amount of RNA template was combined with reverse transcription primers, enzymes, and buffer to construct the reaction system. cDNA was synthesized by reverse transcription at 42°C for 30–60 min, followed by enzyme inactivation at 70°C for 10 min. Using cDNA as the template, specific primers (Table 1), qPCR premix, and RNase-free water were mixed to prepare the reaction system, which was centrifuged to remove bubbles and then placed in a qPCR instrument. The reaction program was set as follows: pre-denaturation at 95°C for 30 s, cyclic amplification (denaturation at 95°C for 5 s, annealing/extension at 60°C for 30 s, 40 cycles), and melting curve analysis (95°C for 15 s, 60°C for 1 min, 95°C for 15 s). β-actin was used as the internal reference gene, and a negative control was included. Finally, the relative expression levels of target genes (Il17a, Ifng, Il4, etc.)

were calculated using the 2^(-ΔΔCt) method based on Ct values, and amplification specificity was verified by melting curve analysis followed by statistical analysis.

2.10 Statistical analysis

Statistical analysis was performed using Graphpad Prism 10.1.2, with all data presented as mean ± standard error of the mean (X ± SEM). For data conforming to normal distribution with homogeneity of variance, intergroup differences were analyzed by one-way ANOVA followed by Fisher’s least significant difference (LSD) post hoc test. The Kruskal-Wallis H test was employed for non-normally distributed data. A P-value < 0.05 was considered statistically significant.

3. Results

3.1 Behavioral outcome differences between susceptible and resilient groups in CSDS-induced mice

Compared with the control group mice, the susceptible group mice exhibited significantly reduced center region dwelling time in the open field test (Fig. 1B), decreased sucrose preference (Fig. 1C), and increased immobility time in the forced swim test (Fig. 1D). Although the resilient group mice displayed depressive behaviors in both the open field test and forced swim test, these behaviors were markedly milder than those in the susceptible group. Additionally, no significant difference in sucrose preference was observed between the resilient group and the control group.

3.2 Proteomic-level variations exist among different groups of mice

The peripheral Olink proteomics analysis revealed that, compared to the control group, the susceptible group exhibited 74 differentially expressed proteins (Fig. 2A). Hierarchical clustering heatmap analysis demonstrated that these differential proteins were primarily associated with three biological processes: immune and inflammatory responses, cell proliferation and differentiation, and energy metabolism and signal transduction (Fig. 2C). KEGG enrichment analysis indicated that the differential proteins were mainly enriched in immune signaling (cytokine pathways), virus-related regulation, disease pathological processes, and genetic information processing (Fig. 3A). Compared to the resistant group, the susceptible group exhibited 30 differentially expressed proteins (Fig. 2B). Hierarchical clustering heatmap analysis revealed that these differential proteins were primarily associated with two biological processes: immune and signaling regulation, and microenvironment and proliferation regulation (Fig. 2D). KEGG enrichment analysis demonstrated that the differential proteins were mainly enriched in pathways related to cellular senescence, immune signaling, mRNA regulation, cancer-associated signaling, and metabolic remodeling (Fig. 3B).

After screening, a total of 5 differential proteins (CXCL1, EBI3_IL27, LRIG1, NAGK, SPN) and 2 pathways (sa04060, hsa04657) were found to be common between the susceptible group vs control group and susceptible group vs resistant group. Among them, the expression levels of 4 proteins (EBI3_IL27, LRIG1, NAGK, SPN) in the resistant group showed no difference compared to the control group but exhibited significant differences from the susceptible group (Fig.s 4A-E), all of which were associated with Treg cells (Fig. 4F). The two shared pathways were sa04060 (cytokine-cytokine receptor interaction) and hsa04657 (IL-17 signaling pathway), both related to cytokine signaling pathways.

3.3 The 5-HT1A receptor antagonist WAY100635 can reverse the changes in inflammatory-related cytokines

Primary Treg cells and microglia were co-cultured from C57BL/6J mice. RT-qPCR results showed that 5-HT could downregulate the expression of Il17a and Ifng mRNA, while increasing the expression level of Il4 mRNA. These changes could be effectively reversed by WAY100635 (Fig. 5).

Fig. 1

CSDS experimental procedure and behavioral test results

Note

A: CSDS procedure; B: Time in center zone of open field test; C: Sucrose preference; D: Immobility time in forced swim test; ^*P<0.05, ^**P<0.01,^***P<0.001, ^****P<0.0001.

Fig. 2

Volcano plots and heatmap results of differential proteins in each group

Note

A, C: Susceptible vs Control ; B, D: Susceptible vs Resistant.

Fig. 3

Results of KEGG enrichment analysis

Note

A: Susceptible vs Control; B: Susceptible vs Resistant

Fig. 4

Differential protein expression levels and Treg regulatory network

Note

A-E: Expression levels of common differentially expressed proteins, ^*P<0.05, ^**P<0.01,^***P<0.001, ^****P<0.0001; F: Relationship between differentially expressed proteins and Treg; G: Treg immunoregulatory network; H: Effects of partial cytokines on microglial polarization.

Fig. 5

Expression levels of Il17a, Ifng and Il4 mRNA in the co-culture system

4. Discussion

The CSDS depression model, which uses social stress as the modeling inducer, aligns more closely with the core pathogenic factors of human depression. It can stably induce typical depression-like behaviors such as social avoidance and anhedonia, demonstrating certain advantages. This experiment compared the naturally segregated stress-susceptible and stress-resilient mouse subpopulations in this model, evaluating behavioral differences across multiple dimensions.

To further elucidate the mechanisms underlying stress susceptibility, we conducted peripheral blood analyses in each group of mice. Based on Olink targeted proteomics combined with KEGG pathway enrichment analysis, this study identified four common differentially expressed proteins (EBI3_IL27, LRIG1, NAGK, SPN) and two significantly enriched core differential pathways—sa04060 (Cytokine-cytokine receptor interaction) and hsa04657 (IL-17 signaling pathway). EBI3_IL27 encodes the β subunit of IL-27, whose core function is to specifically induce the proliferation and immunosuppressive function of Tregs(Lanzar et al. 2025). The cell surface protein LRIG1 is a key molecule regulating the function of inhibitory T cells, which is highly expressed on Tregs and closely related to their immunosuppressive function(Moon et al. 2023). SPN (CD43) is a large transmembrane protein involved in T cell activation and plays a role in the activation of Treg cells(Fay et al. 2018). NAGK (N-acetylglucosamine kinase) participates in the hexosamine salvage synthesis pathway(Campbell et al. 2021) and may influence Treg function through metabolic and immune signaling pathways. hsa04060 represents the Cytokine-cytokine receptor interaction pathway, a core pathway mediating immune signal transduction that encompasses the binding and signaling processes of various pro-inflammatory and anti-inflammatory cytokines with their receptors. Multiple cytokine signaling pathways essential for the differentiation and function of Treg cells fall under the hsa04060 category(Zong et al. 2024; Li et al. 2022; Wang et al. 2023). hsa04657 denotes the IL-17 signaling pathway, a specific pro-inflammatory pathway regulated by Treg cells, with IL-17A as its central effector molecule that amplifies pro-inflammatory responses through downstream signaling activation(Piepke et al. 2021). These findings collectively indicate that Treg cells serve as pivotal cellular mediators influencing stress susceptibility in model mice.

IL-17A, IFN-γ (pro-inflammatory), and IL-4 (anti-inflammatory) are the core cytokines of the central immune-neuroinflammatory network. They mediate inflammation or repair by regulating microglial polarization (M1/M2)(Chen et al. 2022; Kwon et al. 2020), and their expression and activity are regulated by Treg to maintain central homeostasis(Yan et al. 2023; Webster et al. 2022). Clinical study results showed that in peripheral lymphocytes of patients with major depressive disorder, the expression of 5-HT1A receptors in CD4⁺CD25⁺Treg cells was significantly downregulated(Li et al. 2010), suggesting that susceptibility in CSDS mice may be associated with 5-HT1A⁺ Treg cells migrating from the periphery to the central nervous system. Meanwhile, the bidirectional regulatory interaction between Treg cells and microglia represents one of the core mechanisms in maintaining the homeostasis of the inflammatory microenvironment in the central nervous system(Zheng et al. 2025). Therefore, to further explore the molecular biological basis of this interaction, we established a co-culture system of Treg cells and microglia and validated the changes in pro-inflammatory and anti-inflammatory cytokines. The experimental results demonstrated that 5-HT could downregulate the expression of pro-inflammatory cytokines and increase the levels of anti-inflammatory cytokines, while the 5-HT1A inhibitor effectively reversed these changes. Thus, we speculate that in CSDS, 5-HT1A⁺ Treg cells and their associated cytokine pathways may serve as key mediators determining stress susceptibility or resilience.

Although this study has achieved phased results, there are still many directions worthy of further exploration. Firstly, at the mechanistic level, it is necessary to further clarify the specific roles of the four differential proteins in regulating microglial polarization and cytokine secretion by 5-HT1A⁺Treg cells, and elucidate their upstream and downstream regulatory relationships with the 5-HT1A receptor signaling pathway. Meanwhile, single-cell sequencing technology could be employed to analyze the heterogeneity characteristics of 5-HT1A⁺Treg cells in the CSDS model, and determine their infiltration patterns and functional differences across various brain regions (such as the hippocampus and amygdala, which are associated with emotion regulation). Additionally, exploring biomarkers in peripheral blood for screening stress-susceptible populations could provide new strategies and approaches for the prevention and treatment of depression.

Acknowledgements

We would like to express our gratitude to the Department of Pharmacy, Medical Support Center of the Chinese People's Liberation Army General Hospital for their support in this research.

Author Contribution

Article conceptualisation, Y.B.W., and Y.H.; methodology, X.C.Z.and L.J.L.; formal analysis, B.B.B. and J.R.; writing— original draft and editing, Y.B.W.; writing—review and editing, Y.H. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by National Natural Science Foundation of China (No. 82274126).

Declaration of competing interest

The authors have declared that this research was conducted without any conflicts of interest.

Clinical trial number

Not applicable.

Data Availability

The core analytical data of this study have been presented in the main text. The complete raw data are available from the corresponding author [Yuan Hu, email: huyuan1980619@126.com] upon reasonable request.The clinical trial number is not applicable.

REFERENCES

Afridi R, Suk K (2023) Microglial Responses to Stress-Induced Depression: Causes and Consequences. Cells 12. https://doi.org/10.3390/cells12111521

Campbell S, Mesaros C, Izzo L et al (2021) Glutamine deprivation triggers NAGK-dependent hexosamine salvage. Elife 10. https://doi.org/10.7554/eLife.62644

Chen H, Tang X, Li J et al (2022) IL-17 crosses the blood-brain barrier to trigger neuroinflammation: a novel mechanism in nitroglycerin-induced chronic migraine. J Headache Pain 23:1. https://doi.org/10.1186/s10194-021-01374-9

Daray FM, Grendas LN, Arena Á, R., et al (2024) Decoding the inflammatory signature of the major depressive episode: insights from peripheral immunophenotyping in active and remitted condition, a case-control study. Transl Psychiatry 14:254. https://doi.org/10.1038/s41398-024-02902-2

Fay KT, Chihade DB, Chen CW et al (2018) Increased mortality in CD43-deficient mice during sepsis. PLoS ONE 13:e0202656. https://doi.org/10.1371/journal.pone.0202656

Feng X, Jia M, Cai M et al (2025) Central-peripheral neuroimmune dynamics in psychological stress and depression: insights from current research. Mol Psychiatry 30:4881–4898. https://doi.org/10.1038/s41380-025-03085-y

Kokkosis AG, Madeira MM, Hage Z et al (2024) Chronic psychosocial stress triggers microglial-/macrophage-induced inflammatory responses leading to neuronal dysfunction and depressive-related behavior. Glia 72:111–132. https://doi.org/10.1002/glia.24464

Kwon HS, Koh SH (2020) Neuroinflammation in neurodegenerative disorders: the roles of microglia and astrocytes. Transl Neurodegener 9:42. https://doi.org/10.1186/s40035-020-00221-2

Lanzar ZR, Aldridge DL, Cruz-Morales E et al (2025) IL-27 promotes Treg cell expression of CD122 and fitness at homeostasis. Proc Natl Acad Sci U S A 122:e2519141122. https://doi.org/10.1073/pnas.2519141122

Li Y, Li X, Geng X et al (2022) The IL-2A receptor pathway and its role in lymphocyte differentiation and function. Cytokine Growth Factor Rev 67:66–79. https://doi.org/10.1016/j.cytogfr.2022.06.004

Li Y, Xiao B, Qiu W et al (2010) Altered expression of CD4(+)CD25(+) regulatory T cells and its 5-HT(1a) receptor in patients with major depression disorder. J Affect Disord 124:68–75. https://doi.org/10.1016/j.jad.2009.10.018

Matsuno H, Tsuchimine S, O'Hashi K et al (2022) Association between vascular endothelial growth factor-mediated blood-brain barrier dysfunction and stress-induced depression. Mol Psychiatry 27:3822–3832. https://doi.org/10.1038/s41380-022-01618-3

Moon JS, Ho CC, Park JH et al (2023) Lrig1-expression confers suppressive function to CD4(+) cells and is essential for averting autoimmunity via the Smad2/3/Foxp3 axis. Nat Commun 14:5382. https://doi.org/10.1038/s41467-023-40986-4

Muhammad RN, Ahmed LA, Salam A, R. M., et al (2021) Crosstalk Among NLRP3 Inflammasome, ET(B)R Signaling, and miRNAs in Stress-Induced Depression-Like Behavior: a Modulatory Role for SGLT2 Inhibitors. Neurotherapeutics 18:2664–2681. https://doi.org/10.1007/s13311-021-01140-4

Piepke M, Clausen BH, Ludewig P et al (2021) Interleukin-10 improves stroke outcome by controlling the detrimental Interleukin-17A response. J Neuroinflammation 18:265. https://doi.org/10.1186/s12974-021-02316-7

Sørensen NV, Borbye-Lorenzen N, Christensen RHB et al (2023) Comparisons of 25 cerebrospinal fluid cytokines in a case-control study of 106 patients with recent-onset depression and 106 individually matched healthy subjects. J Neuroinflammation 20:90. https://doi.org/10.1186/s12974-023-02757-2

Suneson K, Grudet C, Ventorp F et al (2023) An inflamed subtype of difficult-to-treat depression. Prog Neuropsychopharmacol Biol Psychiatry 125:110763. https://doi.org/10.1016/j.pnpbp.2023.110763

Wang J, Zhao X, Wan YY (2023) Intricacies of TGF-β signaling in Treg and Th17 cell biology. Cell Mol Immunol 20:1002–1022. https://doi.org/10.1038/s41423-023-01036-7

Warren AL, Zilberg G, Abbassi A et al (2025) Structural determinants of G protein subtype selectivity at the serotonin receptor 5-HT1A. Sci Adv. 11:eadu9851. https://doi.org/10.1126/sciadv.adu9851

Webster HC, Gamino V, Andrusaite AT et al (2022) Tissue-based IL-10 signalling in helminth infection limits IFNγ expression and promotes the intestinal Th2 response. Mucosal Immunol 15:1257–1269. https://doi.org/10.1038/s41385-022-00513-y

Yan K, Zhang F, Ren J et al (2023) MicroRNA-125a-5p regulates the effect of Tregs on Th1 and Th17 through targeting ETS-1/STAT3 in psoriasis. J Transl Med 21:678. https://doi.org/10.1186/s12967-023-04427-6

Zheng Y, Ren Z, Liu Y et al (2025) T cell interactions with microglia in immune-inflammatory processes of ischemic stroke. Neural Regen Res 20:1277–1292. https://doi.org/10.4103/nrr.Nrr-d-23-01385

Zhou J, Wu JW, Song BL et al (2024) 5-HT1A receptors within the intermediate lateral septum modulate stress vulnerability in male mice. Prog Neuropsychopharmacol Biol Psychiatry 132:110966. https://doi.org/10.1016/j.pnpbp.2024.110966

Zong Y, Deng K, Chong WP (2024) Regulation of Treg cells by cytokine signaling and co-stimulatory molecules. Front Immunol 15:1387975. https://doi.org/10.3389/fimmu.2024.1387975

Yes

5-HT1A + Treg cells and their associated signaling pathways may be the key mediators determining susceptibility in mouse models of depression