A
C/EBPγ Activation of β-Catenin Pathway Through Interaction With C/EBPα In Idiopathic Pulmonary Fibrosis
Xiaoyue Pan#1, Yulong Gan1, Ying Cao1, Man Zhao1, Cong Xia1, Huibing Liu1, Yanlin Zhou1, Yuqi Wang1, Zhongzheng Li1, Bin Li1, Lan Wang1*, Guoying Yu1*
1State Key Laboratory of Cell Differentiation and Regulation, Henan International Joint Laboratory of Pulmonary Fibrosis, Henan Center for Outstanding Overseas Scientists of Organ Fibrosis, Pingyuan Lab, College of Life Science, Henan Normal University, Xinxiang 453007, China
Correspondence to: Guoying Yu, PhD
Email: guoyingyu@htu.edu.cn
Henan Normal University, 46 Jianshe Road, Xinxiang, Henan 453007, China
Tel:86−373−3326340
Lan Wang, PhD
Email: 041099@htu.edu.cn
Tel:86−373−3326341
Henan Normal University, 46 Jianshe Road, Xinxiang, Henan 453007, China
Abstract
Abstract:
A
Idiopathic pulmonary fibrosis (IPF) is a progressive and fatal interstitial lung disease marked by abnormal epithelial-mesenchymal transition (EMT) and fibroblast activation, though the molecular mechanisms driving these processes remain unclear. Here, we report that the CCAAT enhancer binding protein γ (C/EBPγ), a transcription factor, is significantly upregulated in IPF lung tissues, bleomycin-induced fibrotic mouse lungs. C/EBPγ overexpression promoted EMT in A549 cells, as evidenced by decreased E-cadherin, increased N-cadherin and vimentin, alongside enhanced fibroblast migration and fibrotic marker upregulation (Collagen I, fibronectin, and α-SMA) in MRC-5 cells. Mechanistically, C/EBPγ activated β-catenin pathway by stabilizing β-catenin through transcriptional repression of AXIN1, a key component of the degradation complex. This repression occurred via interaction with C/EBPα, antagonizing its promotion of AXIN1 expression, as confirmed by co-immunoprecipitation, immunofluorescence, and rescue experiments. In vivo, adeno-associated virus-mediated C/EBPγ overexpression aggravated pulmonary fibrosis induced by bleomycin in mice, enhancing collagen deposition, inflammation, and β-catenin expression, whereas knockdown alleviated these changes. Collectively, downregulation of C/EBPγ plays significant antifibrotic role via the C/EBPα-AXIN1-β-catenin axis, highlighting its therapeutic potential for IPF intervention.
Key words:
Idiopathic pulmonary fibrosis
C/EBPγ
β-catenin signaling
AXIN1
C/EBPα
A
Introduction
Idiopathic pulmonary fibrosis (IPF) is a chronic interstitial lung disorder marked by persistent alveolar injury and dysregulated tissue repair, leading to progressive fibrosis and decline in pulmonary function [1, 2]. IPF predominantly affects middle-aged and elderly individuals, particularly men over 65 years of age, with its incidence steadily rising worldwide [3, 4]. The disease is associated with an unfavorable prognosis, with a median survival of approximately 3–5 years following diagnosis [5], severely impairing patients' quality of life and imposing a significant burden on healthcare systems[4]. While the etiology is multifactorial—involving environmental exposures, genetic predisposition, and immune dysregulation [6]—current treatments, such as pirfenidone and nintedanib, primarily aim to slow progression, though their efficacy varies and no curative options exist [7, 8]. Recently, the oral phosphodiesterase 4B (PDE4B) inhibitor nerandomilast has been approved in China, demonstrating antifibrotic and anti-inflammatory effects in Phase II trials [9], providing a novel therapeutic avenue. However, further elucidation of the underlying mechanisms and development of targeted therapies are essential to enhance long-term outcomes.
Multiple signaling cascades, such as TGF-β/Smad, Wnt/β-catenin, Notch, and inflammation-associated pathways, are disrupted in the pathogenesis of IPF [10]. These signaling cascades play vital roles in controlling cellular differentiation, proliferation, apoptosis, and the balance of extracellular matrix (ECM) production and degradation, with notable crosstalk such as TGF-β enhancing Wnt/β-catenin to promote ECM deposition and fibroblast activation, contributing to IPF progression [11]. Among these pathways, Wnt/β-catenin signaling is particularly notable for its pivotal role in promoting fibrotic progression. Wnt signaling stabilizes β-catenin, facilitating its nuclear accumulation and activation of downstream genes encoding ECM components and pro-fibrotic factors [12]. Upregulation of multiple Wnt/β-catenin pathway components has been observed in IPF lungs, correlating with disease severity [13]. Targeting Wnt/β-catenin shows therapeutic promise; for instance, inhibitors reduce collagen deposition by up to 50% and improve lung function in bleomycin-induced models [14]. Our recent work demonstrated that TRIOBP modulates miR-29b to influence the β-catenin pathway, underscoring its critical role in IPF pathogenesis [15]. These insights affirm β-catenin's centrality in IPF and position it as a viable therapeutic target.
CCAAT enhancer binding protein γ (C/EBPγ), a relatively understudied member of the C/EBP family, is the smallest and simplest, comprising only a leucine zipper and basic region without activation domains (AD) or negative regulatory domains (RD) [16]. This minimal structure has long been thought to constrain its functional potential. However, emerging evidence reveals C/EBPγ's involvement in various disease pathogeneses, highlighting its broader significance [1720]. Its role in fibrotic disorders, however, remains poorly defined. In skin fibrosis, C/EBPγ is implicated in indirectly promoting fibroblast activation and matrix remodeling [21]. While direct evidence in pulmonary fibrosis is lacking, prior work shows that C/EBPγ is upregulated by IL-1β in LPS- or immunoglobulin-mediated lung inflammation models, conferring protection through decreased vascular permeability, restricted neutrophil infiltration, and reduced inflammatory mediator release [22]. Furthermore, C/EBPγ overexpression has been shown to attenuate inflammatory responses by antagonizing the transcriptional activity of other members such as C/EBPβ and C/EBPδ [22] and downregulating cytokines such as IL-6 [23]. Consequently, C/EBPγ is often viewed as an anti-inflammatory regulator, prompting speculation that it might mitigate fibrosis via immunomodulation. However, this notion has not been experimentally validated in pulmonary fibrosis, and critical gaps remain regarding its functional role in lung fibroblasts and its potential interactions with core fibrogenic signaling cascades. Importantly, fibrosis differs from acute inflammation; although inflammation can trigger remodeling, fibrotic progression entails sustained transcriptional changes, aberrant epithelial-mesenchymal transition, and extracellular matrix buildup. Thus, whether C/EBPγ acts protectively or paradoxically drives fibrosis in chronic injury settings remains a key unresolved question with clinical implications.
This study sought to investigate the potential involvement of C/EBPγ in pulmonary fibrosis, as its role in this process remains unknown. Through immunohistochemical and immunofluorescence analyses, we found that C/EBPγ expression was markedly elevated in lungs of IPF patients and similarly increased in the lungs of bleomycin-induced fibrotic mice. To clarify the function and molecular mechanisms of C/EBPγ in pulmonary fibrosis, we performed loss- and gain-of-function experiments in A549 and MRC-5 cells. C/EBPγ overexpression enhanced EMT in A549 cells, as well as fibroblast-to-myofibroblast transition (FMT) in MRC-5 cells. Mechanistically, C/EBPγ enhanced β-catenin signaling by stabilizing the protein and promoting its nuclear accumulation. Rather than directly regulating β-catenin transcription, C/EBPγ interacted with C/EBPα to repress Axin1 expression, thereby limiting β-catenin phosphorylation and subsequent degradation. In line with these observations, adeno-associated virus–driven C/EBPγ overexpression exacerbated bleomycin-induced pulmonary fibrosis in vivo, while its silencing mitigated the fibrotic response.
Materials and methods
Cell culture and treatment
The human alveolar epithelial cell line A549 and the lung fibroblast cell line MRC-5 were obtained from the American Type Culture Collection (ATCC, USA). Cultures were maintained in conventional medium containing 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 µg/mL streptomycin, under humidified conditions at 37°C with 5% CO₂. All cell lines were regularly examined and confirmed to be free of mycoplasma contamination.
When cultures reached nearly 80% confluence, cells were detached with 0.25% trypsin–EDTA and reseeded into six-well plates (Corning, NY, USA) at a density of 1.0 × 10⁵ cells per well. Transfection was carried out once cultures reached about 70–80% confluence to ensure both high efficiency and good cell survival. For stimulation assays, cells were deprived of serum for 24 hours before being exposed to specific agents, such as recombinant human transforming growth factor-β1 (rhTGF-β1) or bleomycin (BLM), depending on the experimental setup.
Plasmids and transfection
Human expression plasmids pcDNA3.1-C/EBPγ, pcDNA3.1-C/EBPα, and the truncation mutant pcDNA3.1-C/EBPγ ΔbZIP, as well as phage-Flag-tagged constructs for AXIN1 and β-catenin, and their corresponding empty vectors, were transfected into A549 and MRC-5 cells using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer’s instructions.
A
For gene silencing experiments, small interfering RNA (siRNA) targeting human C/EBPγ was purchased from RiboBio Co., Ltd. (Guangzhou, China). Transfections were carried out using the corresponding siRNA transfection reagent provided by the same manufacturer, following the recommended protocol.
A
Western blot analysis
Lung tissues and cultured cells were lysed in SDS buffer (P0013B, Beyotime, Shanghai, China) containing protease and phosphatase inhibitors. Protein levels in the supernatant were quantified with a BCA assay kit (Solarbio, Beijing, China). Equal protein samples were resolved on 8–12% SDS–PAGE gels and transferred to PVDF membranes (Millipore, Darmstadt, Germany). The membranes were blocked with 5% nonfat milk, then incubated with primary antibodies overnight at 4°C, followed by HRP-conjugated secondary antibodies at room temperature for 1 h. Immunoreactive bands were detected using the Odyssey Fc Imaging System (LI-COR Biosciences, Lincoln, NE, USA). The following antibodies were used: C/EBPγ (Thermo Fisher Scientific, #PA5-101128), β-actin (Affinity, #T0022), α-SMA (Cell Signaling Technology, #19245), COL1A1 (Cell Signaling Technology, #72026), E-cadherin (Cell Signaling Technology, 14472S), N-cadherin (Cell Signaling Technology, #13116), Vimentin (Proteintech, 10366-1-AP), Fibronectin (Cell Signaling Technology, #26836), β-catenin (Proteintech, #51067-2), phos-β-catenin (T41 + S45) (Abcam, #ab81305), C/EBPα(Proteintech, #29388-1).
Quantitative real-time polymerase chain reaction (qRT–PCR)
For transcriptional analysis of tissue and cultured cells, total RNA was extracted using TRIzol reagent (Takara, Dalian, China) following the manufacturer’s protocol and previously published methods [24]. Complementary DNA (cDNA) was generated using the GoScript™ Reverse Transcription System (Promega, Madison, WI, USA). Quantitative real-time PCR (qRT–PCR) was carried out on a LightCycler 480 instrument (Roche, Basel, Switzerland) with SYBR Green Master Mix (Qiagen, Hilden, Germany) and cDNA as the template. Relative mRNA expression were determined using the 2^−ΔΔCt approach. Primer sequences applied in this study are provided in Table 1.
Table 1
Sequences of primers used for qRT-PCR
Primer name
Oligonucleotide sequence (5’-3’)
human-CEBPG-F
ACTCCAGGGGTGAACGGAAT
human-CEBPG-R
CATGGGCGAACTCTTTTTGCT
human-ACTB-F
GGGAAATCGTGCGTGACAT
human-ACTB-R
CTCATTGCCAATGGTGATGA
human-E-Cadherin-F
CGAGAGCTACACGTTCACGG
human-E-Cadherin-R
GGGTGTCGAGGGAAAAATAGG
human-N-Cadherin-F
TCAGGCGTCTGTAGAGGCTT
human-N-Cadherin-R
ATGCACATCCTTCGATAAGACTG
human-CTNNB1-F
AAAGCGGCTGTTAGTCACTGG
human-CTNNB1-R
CGAGTCATTGCATACTGTCCAT
human-AXIN1-F
GACCTGGGGTATGAGCCTGA
human-AXIN1-R
GGCTTATCCCATCTTGGTCATC
Supplementary Figures and corresponding legend
Collagen Gel Contraction Assay
The contractile ability of MRC-5 fibroblasts was assessed using a collagen gel contraction model based on rat tail collagen type I (Corning, Corning Inc., NY, USA). MRC-5 cells were subjected to the corresponding transfection or pharmacological treatments prior to the assay.
Collagen mixtures were prepared on ice by combining rat tail Collagen I (3 mg/mL), 10× PBS, serum-free medium, and 0.1 M NaOH to adjust the pH to approximately 7.4. The concentration of collagen was finally adjusted to 1.5 mg/mL. Equal volumes of the collagen mixture and cell suspension (5 × 10⁵ cells/mL) were gently mixed and dispensed into 24-well plates (0.5 mL per well). Gels were allowed to polymerize at 37°C for 30–60 minutes, then covered with 0.5 mL of complete medium containing 10% FBS. After incubation for 24–48 hours, the gels were gently released from the well edges using a sterile pipette tip to permit contraction. Images were taken at 0 hour and again at 24 or 48 hours with an inverted microscope, and gel areas were measured using ImageJ (v1.52q). Contraction was quantified as the percentage reduction in area, calculated by (initial area − final area) / initial area × 100%, where a higher percentage reflected greater contractile strength.
Wound healing assay
A sterile marker was used to draw reference lines on the bottom of a sterile six-well plate. A549 and MRC-5 cells were seeded into the wells and cultured overnight. After transfection with either C/EBPγ plasmid or siRNA, and once the cells reached 90–100% confluence, a straight wound was made across the cell monolayer with a sterile pipette tip. The wells were gently rinsed with PBS to clear away detached cells and debris. Images of the scratched area were taken at 0, 24, and 48 hours using an inverted phase-contrast microscope.
Luciferase Reporter Assay
MRC-5 cells were co-transfected with the appropriate plasmids and the TOPFlash-CP rapid-degradation luciferase reporter plasmid (Beyotime, Shanghai, China). After 48 hours of incubation, luciferase activity was determined using the Dual-Luciferase® Reporter Assay System (Promega, Madison, WI, USA) according to the manufacturer’s guidelines. In brief, cells underwent one wash with PBS before being lysed in 1× Passive Lysis Buffer (PLB, 100 µL per well in a 24-well plate) for 15 minutes at room temperature with gentle shaking. The lysates were then collected, centrifuged at 4°C to remove debris, and the collected supernatants were then transferred to 96-well plates for luminescence measurement.
Luciferase Assay Reagent II (LAR II) was prepared by reconstituting the lyophilized substrate in Luciferase Assay Buffer II and stored at − 80°C until use. Before measurement, both LAR II and cell lysates were equilibrated to room temperature. For each sample, 20 µL of cell lysate was mixed with 100 µL of LAR II solution, and luminescence was recorded immediately using a microplate luminometer. Relative light units (RLU) representing luciferase activity were adjusted according to total protein levels quantified via the BCA assay. Non-transfected controls (NTC) were included to adjust for background signals. All steps were carried out under low-light conditions to minimize nonspecific luminescence interference.
Immunohistochemistry (IHC) and Immunocytochemistry (ICC)
Lung samples were fixed in 4% paraformaldehyde, paraffin-embedded, and sliced into 4 µm sections. After deparaffinization and rehydration, the slices were incubated with an endogenous peroxidase blocking solution (Beyotime, Shanghai, China) for 10 min to quench peroxidase activity. Antigen retrieval was carried out in Tris-EDTA buffer (Beyotime) at 100°C for 10 minutes. After PBS rinsing, samples were blocked with blocking buffer at 37°C for 30 minutes, then incubated with primary antibodies against C/EBPγ at room temperature. Following additional PBS washes, biotin-conjugated secondary antibodies (Beyotime) were incubated at 37°C for 30 minutes. Staining was developed using a DAB substrate, followed by hematoxylin counterstaining. Images were obtained with a light microscope.
For immunocytochemistry, cells were seeded onto poly-L-lysine–coated coverslips, fixed with 4% paraformaldehyde for 30 min, and subsequently permeabilized using 0.03% Triton X-100 for 5 min. After three PBS rinses, they were blocked with 5% goat serum for 30 min and incubated with primary antibodies targeting β-catenin, HA, or C/EBPα overnight at 4°C. The following day, cells were exposed to Alexa Fluor 488– (green) or Alexa Fluor 594– (red) conjugated secondary antibodies at 37°C for 1 h. Nuclei were stained with DAPI, and fluorescence images were captured using a fluorescence or confocal microscope (LSM 700, Zeiss, Jena, Germany).
Bleomycin-Induced Pulmonary Fibrosis and Human IPF Samples
A
All animal procedures were performed according to the Institutional Animal Care and Use Committee (IACUC) guidelines of Henan Normal University (Approval No. SMKX-2118BS1018) and adhered to national regulations and the principles of the Association for the Study of Animal Behavior. Male C57BL/6N mice (8–10 weeks old) were obtained from Charles River Laboratories (Beijing, China) maintained under specific pathogen-free (SPF) conditions.
In the bleomycin-induced pulmonary fibrosis model, mice were administered a single intratracheal dose of 50 µL bleomycin (1.5 U/kg; Kyorin Pharmaceutical, Tokyo, Japan) dissolved in PBS, or PBS alone as a vehicle control. Mice were euthanized at specified time points via intraperitoneal injection of urethane, and lung tissues were harvested for further analysis.
Lung tissue specimens obtained from patients diagnosed with IPF and non-fibrotic controls were sourced from Henan Provincial Chest Hospital, in accordance with the ATS/ERS/JRS/ALAT clinical practice guidelines. The study received approval from the Ethics Committee of Henan Provincial Chest Hospital (Approval No. 2019-05-07), and all participants provided written informed consent prior to surgery. All procedures adhered to the Declaration of Helsinki.
Statistical analysis
All experiments were independently repeated at least three times. Statistical evaluations were performed using GraphPad Prism version 9.0 (GraphPad Software, San Diego, CA, USA). Data normality was examined with the Shapiro–Wilk test. When the data did not follow a normal distribution, comparisons between two groups were carried out using the Mann–Whitney U test; for normally distributed data, an unpaired Student’s t-test was applied. Results are expressed as the mean ± standard deviation (SD). Differences were regarded as statistically significant when P < 0.05.
Results
C/EBPγ is upregulated in IPF lungs and bleomycin-induced fibrotic lungs
The expression of C/EBPγ in lung tissues from patients and bleomycin-induced mouse models was examined to determine its potential involvement in IPF. Immunohistochemical analysis revealed a pronounced increase in C/EBPγ expression in lung tissues from IPF patients compared with non-IPF controls (Fig. 1A). Consistently, elevated C/EBPγ expression was also observed in lung sections from bleomycin-treated mice (Fig. 1B). Immunofluorescence staining further confirmed the upregulation of C/EBPγ, showing strong co-localization with α-SMA–positive regions in IPF lung tissues (Fig. 1C). Similarly, immunofluorescence analysis demonstrated a significant increase in C/EBPγ expression in the lungs of bleomycin-induced pulmonary fibrosis mice (Fig. 1D).
Fig. 1
C/EBPγ expression is upregulated in fibrotic lungs of patients with IPF and bleomycin-treated mice
Representative IHC staining images of C/EBPγ in lung tissue specimens from patients with IPF and non-IPF controls. Scale bars: 100 µm.
Representative IHC staining images of C/EBPγ in lung tissues from control and bleomycin–treated mice. Scale bars: 100 µm.
Representative immunofluorescence images of C/EBPγ and its co-localization with α-SMA–positive fibrotic regions in lung tissues from IPF patients and non-IPF controls. Scale bars: 100 µm.
Representative immunofluorescence images of C/EBPγ and its co-localization with α-SMA–positive regions in control and bleomycin-induced fibrotic mouse lungs. Scale bars: 100 µm.
Click here to Correct
C/EBPγ promotes EMT and fibrotic activation in vitro
Given the observed upregulation of C/EBPγ in fibrotic lung tissues, we next sought to clarify its functional role in pulmonary fibrosis. C/EBPγ siRNA-mediated knockdown experiments were conducted in A549 cells. Western blot showed that silencing C/EBPγ in A549 cells led to an increase of E-cadherin, accompanied by decreased expression of N-cadherin and vimentin (Fig. 2A). Conversely, C/EBPγ overexpression led to an decrease in E-cadherin expression and a concomitant upregulation in N-cadherin and vimentin at both the mRNA (Fig. 2B) and protein levels (Fig. 2C). In MRC-5 cells, C/EBPγ overexpression also upregulated the fibrotic markers fibronectin and α-SMA, as shown by Western Blot (Fig. 2D), and collagen contraction assays further confirmed that overexpression enhanced the contractile capacity of MRC-5 cells (Fig. 2E).
Fig. 2
C/EBPγ promotes EMT and fibroblast activation
Protein levels of E-cadherin and N-cadherin evaluated by Western blot in C/EBPγ-silenced A549 cells.
Quantitative PCR analysis of E-cadherin, N-cadherin, and Vimentin mRNA expression in C/EBPγ overexpression A549 cells.
Western blot analysis showing E-cadherin, N-cadherin, and vimentin protein expression in A549 cells with C/EBPγ overexpression.
Western blot analysis of fibronectin and α-SMA expression in MRC-5 cells overexpressing C/EBPγ.
Collagen gel contraction assay evaluating contraction changes in C/EBPγ-overexpressing MRC-5 cells
Wound healing assay of C/EBPγ-silenced A549 cells.
Wound healing assay of C/EBPγ-overexpressing A549 cells.
Wound healing assay of C/EBPγ-overexpressing MRC-5 cells. Data representative of n = 3 independent experiments; mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Click here to Correct
Consistent with these molecular changes, wound healing assays demonstrated that C/EBPγ knockdown markedly reduced wound closure (Fig. 2F), while its overexpression significantly increased the migration ability of A549 cells (Fig. 2G) and MRC-5 cells (Fig. 2H). Taken together, these findings indicate that C/EBPγ promotes EMT in A549 cells and FMT in MRC-5 cells, potentially contributing to the progression of pulmonary fibrosis.
C/EBPγ promotes EMT and FMT through β-catenin pathway
Based on the preceding findings, we speculated that C/EBPγ might exacerbate fibrotic progression. To further test this hypothesis, we examined the potential mechanisms through which C/EBPγ regulates fibrosis by analyzing alterations in fibrosis-related signaling pathways under both knockdown and overexpression conditions. Western blot showed that β-catenin protein levels changed in parallel with C/EBPγ expression (Fig. 3A). Consistently, luciferase reporter assays confirmed enhanced β-catenin signaling following C/EBPγ overexpression (Fig. 3B).
Fig. 3
C/EBPγ promotes EMT and fibroblast activation through β-catenin pathway
Western blot analysis of β-catenin protein expression in MRC-5 cells after C/EBPγ overexpression.
Luciferase reporter assay of β-catenin activation in MRC-5 cells after C/EBPγ overexpression (HLY78 was used as positive control).
Western blot analysis of E-cadherin, N-cadherin, vimentin in A549 cells with C/EBPγ knockdown followed by HLY78 treatment.
Protein levels of E-cadherin, N-cadherin, vimentin evaluated by Western blot in C/EBPγ-overexpressing A549 cells treated with MSAB.
Western blot analysis of fibronectin, Collagen I, α-SMA in MRC-5 cells with C/EBPγ knockdown and HLY78 treatment.
Western blot analysis of fibronectin, Collagen I, α-SMA in C/EBPγ-overexpressing MRC-5 cells treated with MSAB.
Collagen gel contraction assay evaluating contraction changes in C/EBPγ-overexpressing MRC-5 cells treated with MSAB.
Immunofluorescence analysis of β-catenin in C/EBPγ-overexpressing A549 cells. Scale bars: 20 µm.
Immunofluorescence detection of β-catenin in C/EBPγ-overexpressing MRC-5 cells. Scale bars: 20 µm. Data representative of n = 3 independent experiments; mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Click here to Correct
Given that β-catenin plays a pivotal role as a profibrotic mediator, we next investigated whether C/EBPγ exerts its effects through this pathway. C/EBPγ was silenced or overexpressed in A549 and MRC-5 cells, followed by treatment with β-catenin agonists or inhibitors. HLY78, a β-catenin pathway agonist that binds the DIX domain of Axin and enhances Axin–LRP6 interaction, was used to activate β-catenin signaling. In A549 cells, administration of HLY78 suppressed E-cadherin expression but enhanced the expression of N-cadherin and vimentin, silencing C/EBPγ partially reversed these changes (Fig. 3C). Conversely, treatment with the β-catenin inhibitor MSAB effectively restored EMT marker expression altered by C/EBPγ overexpression (Fig. 3D).
FMT was also observed in MRC-5 cells, C/EBPγ knockdown attenuated the upregulation of fibrotic markers induced by HLY78, including fibronectin, Collagen I, and α-SMA (Fig. 3E). In contrast, MSAB treatment reversed the increases in these markers caused by C/EBPγ overexpression (Fig. 3F). Consistent results were obtained from the collagen gel contraction assay, in which MSAB reduced the enhanced collagen contractility induced by C/EBPγ overexpression (Fig. 3G). Collectively, these findings suggest that C/EBPγ promotes fibrotic progression by modulating the β-catenin signaling pathway, and that activation or inhibition of this pathway can partially offset the effects of C/EBPγ knockdown or overexpression on FMT and EMT-related markers.
Beyond altering β-catenin protein levels, C/EBPγ also enhanced its nuclear translocation. Immunofluorescence analysis in both A549 (Fig. 3H) and MRC-5 (Fig. 3I) cells showed increased β-catenin accumulation predominantly within the nuclei of C/EBPγ-positive (HA-tag–positive) cells following C/EBPγ overexpression. Since β-catenin nuclear accumulation and subsequent target gene activation constitute major downstream events of Wnt signaling, these results further confirm that C/EBPγ enhances β-catenin signaling activity, thereby contributing to fibrotic progression.
C/EBPγ regulates β-catenin stability through transcriptional repression of AXIN1
We next investigated the mechanism by which C/EBPγ regulates β-catenin. Given that C/EBPγ functions as a transcription factor, we initially hypothesized that it might directly influence β-catenin transcription. However, qPCR analysis revealed that C/EBPγ overexpression did not alter β-catenin mRNA levels (data not shown), suggesting that its regulatory effect occurs post-transcriptionally.
To determine whether C/EBPγ affects β-catenin stability, we examined its degradation rate in MRC-5 cells. Following C/EBPγ overexpression, Cycloheximide (CHX) treatment was applied to block protein synthesis, and β-catenin expression was monitored at different time points. Western blot analysis demonstrated that C/EBPγ markedly slowed β-catenin degradation (Fig. 4A).
Fig. 4
C/EBPγ activates β-catenin through downregulation of AXIN1
Western blot analysis of β-catenin degradation over time in C/EBPγ-overexpressing MRC-5 cells treated with cycloheximide (CHX).
Quantitative PCR analysis of AXIN1 mRNA expression in MRC-5 cells after C/EBPγ overexpression.
Protein levels of AXIN1 and total β-catenin in MRC-5 cells evaluated by Western blot following C/EBPγ overexpression.
Western blot analysis of fibronectin, Collagen I, α-SMA in MRC-5 cells when AXIN1 and C/EBPγ were overexpressed individually or jointly.
Western blot analysis of total β-catenin and β-catenin phosphorylation at Thr41 and Ser45 in MRC-5 cells when AXIN1 and C/EBPγ were overexpressed individually or jointly.
Collagen gel contraction assay evaluating contraction changes of MRC-5 cells after AXIN1 and C/EBPγ were transfected individually or jointly..
Luciferase reporter assay of β-catenin activation in MRC-5 cells after AXIN1 and C/EBPγ were transfected individually or jointly. Data representative of n = 3 independent experiments; mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Click here to Correct
Because β-catenin is targeted for degradation through a destruction complex consisting of AXIN, APC, GSK3, and CK1, we next examined these upstream regulators. qPCR confirmed that AXIN1 mRNA level was decreased following C/EBPγ overexpression (Fig. 4B). Western blotting further validated the suppressive effect of C/EBPγ on AXIN1 protein expression (Fig. 4C). These findings suggest that C/EBPγ inhibits β-catenin degradation by transcriptionally repressing AXIN1.
To validate this mechanism, rescue experiments were performed by co-expressing AXIN1 with C/EBPγ in MRC-5 cells. Western blot analysis showed that AXIN1 restoration markedly reversed the upregulation of fibrotic markers induced by C/EBPγ overexpression (Fig. 4D). Likewise, AXIN1 co-expression partially reduced β-catenin protein level, and induced β-catenin phosphorylation at Thr41 and Ser45 (Fig. 4E). Collagen gel contraction assays showed that C/EBPγ overexpression enhanced the contractile ability of MRC-5 cells, while AXIN1 restoration mitigated this effect (Fig. 4F). Luciferase reporter assays further demonstrated that C/EBPγ significantly activated the β-catenin signaling pathway, whereas AXIN1 restoration attenuated this activation (Fig. 4G). Together, these data indicate that C/EBPγ enhances β-catenin activity by transcriptionally repressing AXIN1, thereby promoting β-catenin stability and downstream fibrotic responses.
C/EBPγ supresses AXIN1 by interaction with C/EBPα
We next investigated the mechanism by which C/EBPγ suppresses AXIN1 expression. C/EBPγ represents the smallest and structurally simplest member of its family, lacking the regulatory domain required for transcriptional activation. It cannot form homodimers but can heterodimerize with other family members, generating “functionally deficient” complexes that typically attenuate the transcriptional activity of their partners’ target genes. Based on these properties and our previous findings, we hypothesized that C/EBPγ represses AXIN1 transcription through interaction with other family members, thereby indirectly activating the β-catenin pathway. Among these family members, C/EBPα has been shown to play a protective role in both pulmonary and hepatic fibrosis by reducing the expression of α-SMA, fibronectin, and Collagen I, thus alleviating fibrotic progression. This prompted us to examine whether C/EBPγ modulates fibrosis through interaction with C/EBPα. C/EBPα overexpression in MRC-5 cells markedly decreased β-catenin protein levels while increasing AXIN1 expression (Fig. 5A). Immunofluorescence analysis showed that C/EBPα overexpression markedly attenuated the HLY78-induced increase in Collagen I, fibronectin and α-SMA levels in MRC-5 cells (Fig. S1A). Consistently, qPCR analysis demonstrated that C/EBPα overexpression markedly increased AXIN1 transcription, whereas co-expression of C/EBPγ partially suppressed this elevation (Fig. 5B). When C/EBPα and C/EBPγ were overexpressed individually or jointly, Western blot showed that C/EBPα partially reversed the upregulation of fibrotic markers induced by C/EBPγ (Fig. 5C). Correspondingly, AXIN1 and phosphorylated β-catenin (Thr41 + Ser45) levels showed parallel changes—C/EBPα elevated AXIN1 and β-catenin phosphorylation, while C/EBPγ antagonized these effects (Fig. 5D). Luciferase reporter assays further showed that C/EBPα and C/EBPγ exerted opposing effects on β-catenin pathway activation, suggesting functional antagonism (Fig. 5E). Collagen gel contraction assays confirmed that the opposing effects of C/EBPα and C/EBPγ on cell contraction were tightly associated with β-catenin signaling activity (Fig. 5F).
Fig. 5
C/EBPγ suppresses AXIN1 through interaction with C/EBPα
Western blot analysis showing β-catenin and AXIN1 protein expression in MRC-5 cells overexpressing C/EBPα.
Quantitative PCR analysis of AXIN1 transcription in MRC-5 cells overexpressing C/EBPα alone or with C/EBPγ.
Western blot analysis of fibronectin, Collagen I, α-SMA in MRC-5 cells overexpressing C/EBPα and C/EBPγ individually or together.
Western blot detection of AXIN1 expression and β-catenin phosphorylation (Thr41 + Ser45) in MRC-5 cells after C/EBPα and C/EBPγ transfection.
Luciferase assay showing β-catenin pathway activation following individual or co-transfection of C/EBPα and C/EBPγ.
Collagen gel contraction assay of MRC-5 cells co-transfected following individual or co-transfection of C/EBPα and C/EBPγ followed by treatment of HLY78.
Co-immunoprecipitation (co-IP) assay demonstrating interaction between C/EBPγ and C/EBPα in 293T cells.
Co-immunoprecipitation analysis showing that the ΔbZIP truncation mutant of C/EBPγ fails to interact with C/EBPα.
Immunofluorescence assay showing nuclear co-localization of C/EBPγ and C/EBPα in MRC-5 cells. Scale bars: 20 µm. Data representative of n = 3 independent experiments; mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Click here to Correct
To investigate whether this regulatory interaction involves direct protein binding, co-immunoprecipitation (co-IP) experiments were performed in 293T cells, which revealed a physical association between C/EBPγ and C/EBPα (Fig. 5G). To assess the functional requirement of this interaction, a human C/EBPγ ΔbZIP truncation construct was generated by deleting the C-terminal basic leucine zipper (bZIP) domain responsible for dimerization (amino acids 101–150) (Figure. S2A), with an HA tag fused to the C-terminus for detection. Co-IP analysis confirmed that the ΔbZIP truncation failed to interact with C/EBPα (Fig. 5H), and showing no effect on fibronectin or α-SMA levels in MRC-5 cells under either basal conditions or stimulation with the β-catenin agonist HLY78 (Figure. S2B). Immunofluorescence staining in MRC-5 cells further showed nuclear co-localization of C/EBPγ (full lenth) and C/EBPα (Fig. 5I). Collectively, these results demonstrate that C/EBPγ suppresses AXIN1 transcription and modulates β-catenin signaling—and consequently fibrosis—through direct interaction with C/EBPα.
AAV-mediated C/EBPγ overexpression exacerbates bleomycin-induced pulmonary fibrosis in mice
To assess the in vivo role of C/EBPγ in pulmonary fibrosis, adeno-associated virus (AAV) vectors were used to overexpress C/EBPγ in mouse lungs, followed by bleomycin (BLM) administration to induce fibrosis (Fig. 6A).
Fig. 6
C/EBPγ overexpression aggravated bleomycin-induced mouse lung fibrosis
Schematic illustration of adeno-associated virus (AAV2/9)-mediated C/EBPγ overexpression followed by bleomycin (BLM) administration.
Representative western blot images and quantification of α-SMA, fibronectin, and Collagen I protein levels in lung tissues.
Immunofluorescence co-staining of C/EBPγ and β-catenin. Scale bars: 100 µm.
Representative micro-CT images showing increased parenchymal opacity and alveolar collapse in C/EBPγ-overexpressing mice.
Quantification of the lung-to-body weight ratio (n = 8/group).
Hydroxyproline content in lung tissues (n = 8/group).
Total leukocyte counts in BALF (n = 8/group).
Quantitative evaluation of pulmonary fibrosis severity using the Ashcroft score.
Representative histological images of lung sections stained with H&E, Masson’s trichrome, and α-SMA immunohistochemistry, showing aggravated alveolar destruction, collagen deposition, and myofibroblast accumulation in each group. Scale bars = 100 µm. Data representative of n = 3 independent experiments; mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Click here to Correct
Mice with C/EBPγ overexpression exhibited markedly aggravated fibrotic changes compared with the BLM group. Western blot analysis demonstrated substantial upregulation of α-SMA, Collagen I, and fibronectin (Fig. 6B). Immunofluorescence analysis revealed that β-catenin levels in mouse lung tissues increased concomitantly with the elevated expression of C/EBPγ (Fig. 6C). Micro-CT imaging revealed pronounced parenchymal opacities and alveolar collapse (Fig. 6D), accompanied by a marked increase in lung-to-body weight ratio (Fig. 6E) and elevated hydroxyproline content (Fig. 6F), indicating excessive collagen deposition. An increased leukocyte count was observed in the bronchoalveolar lavage fluid (BALF) of C/EBPγ overexpression mice (Fig. 6G), reflecting intensified inflammation. Histopathological evaluation by H&E, Masson’s trichrome, and α-SMA immunohistochemical staining, revealed markedly aggravated alveolar structural distortion, collagen deposition, and myofibroblast accumulation in the lungs of C/EBPγ-overexpressing mice compared with BLM-treated controls (Fig. 6I). These findings confirm that C/EBPγ acts as a positive regulator of pulmonary fibrosis through β-catenin–dependent pathways.
AAV-mediated C/EBPγ knockdown attenuates bleomycin-induced pulmonary fibrosis in mice
Mice were administered adeno-associated virus carrying shRNA targeting C/EBPγ (AAV-shC/EBPγ) to achieve gene knockdown, followed by bleomycin (BLM) treatment to induce pulmonary fibrosis (Fig. 7A). Western blot showed that α-SMA, Collagen I, and FN protein levels were markedly downregulated (Fig. 7B). Immunofluorescence analysis showed that β-catenin levels in mouse lung tissues were reduced in parallel with the decreased expression of C/EBPγ (Fig. 7C). Micro-CT imaging revealed improved alveolar architecture and reduced fibrotic lesions (Fig. 7D), whereas both lung-to-body weight ratio (Fig. 7E) and hydroxyproline content (Fig. 7F) were decreased. BALF leukocyte counts were reduced (Fig. 7G), indicating diminished inflammation. Histological analyses further confirmed these findings, as H&E and Masson staining revealed markedly reduced alveolar damage and collagen deposition, while α-SMA immunohistochemistry showed decreased myofibroblast activation in C/EBPγ knockdown mice compared with controls (Fig. 7I). Collectively, these in vivo findings demonstrate that suppression of C/EBPγ effectively mitigates fibrotic progression.
Fig. 7
C/EBPγ knockdown attenuated bleomycin-induced mouse lung fibrosis
Schematic illustration of adeno-associated virus (AAV2/9)–mediated C/EBPγ knockdown followed by bleomycin (BLM) administration.
Representative western blot images and quantification of α-SMA, fibronectin, and Collagen I protein levels in lung tissues.
Immunofluorescence co-staining of C/EBPγ and β-catenin. Scale bars: 100 µm.
Representative micro-CT images showing reduced parenchymal opacity and preserved alveolar structure in C/EBPγ-silenced mice compared with the BLM group.
Quantification of the lung-to-body weight ratio (n = 8/group).
Hydroxyproline content in lung tissues (n = 8/group).
Total leukocyte counts in BALF (n = 8/group).
Quantitative evaluation of pulmonary fibrosis severity using the Ashcroft score.
Representative histological images of lung sections stained with hematoxylin–eosin (H&E), Masson’s trichrome, and α-SMA immunohistochemistry. Scale bars: 100 µm. Data representative of n = 3 independent experiments; mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Click here to Correct
Discussion
IPF constitutes a progressive interstitial lung disease of uncertain etiology, characterized by declining respiratory capacity and poor clinical outcomes [25]. The primary pathological characteristic of IPF is the abnormal activation of fibroblasts and the excessive accumulation of extracellular matrix (ECM) in the lung tissue [1, 26]. While antifibrotic agents like pirfenidone and nintedanib modestly delay disease progression, their therapeutic impact is limited, with median survival still confined to 3–5 years. Thus, new mechanisms and targeted therapies are urgently needed [27]. In recent years, the role of transcription factors in regulating the pathogenesis of IPF has garnered increasing attention [2831]. This study found that C/EBPγ was significantly upregulated in both IPF patient lung tissues and in a mouse model of bleomycin-induced fibrosis. Functional experiments revealed that C/EBPγ knockdown suppressed the fibrotic phenotype, while its overexpression promoted EMT, fibroblast activation, and ECM deposition. Mechanistic investigations showed that C/EBPγ exerts a pro-fibrotic effect by downregulating AXIN1, thereby stabilizing β-catenin, promoting its nuclear translocation, and activating downstream signaling pathways. Additionally, C/EBPγ forms a heterodimer with C/EBPα, which reduces AXIN1 transcriptional activity and regulates the AXIN1–β-catenin axis. In the AAV-mediated mouse model, overexpression of C/EBPγ exacerbated pulmonary fibrosis, while its knockdown alleviated the disease. These results not only underscore the pro-fibrotic role of C/EBPγ in IPF but also shed light on the the regulatory network of transcription factor families.
Identified in 2003 as a major profibrotic signaling cascade in IPF, Wnt/β-catenin signaling serves as a pivotal mechanism underlying the progression of pulmonary fibrosis. Chilosi et al. first reported the abnormal nuclear accumulation of β-catenin in the lung tissues of IPF patients, demonstrating that the activation of this pathway is linked to the abnormal proliferation of lung epithelial cells and fibrosis [13]. Subsequent studies have confirmed that Wnt/β-catenin signaling is functionally upregulated in lung fibroblasts from IPF patients, promoting their proliferation and ECM deposition [32]. In experimental models, suppression of the β-catenin pathway markedly attenuated bleomycin-induced pulmonary fibrosis in mice, as evidenced by reduced inflammation and ECM accumulation [14, 33]. The Wnt co-receptor LRP5 has been identified as a key driver of IPF, and its deficiency has been shown to alleviate fibrosis in mice [34]. At the mechanistic level, β-catenin acts in synergy with TGF-β signaling, which promotes β-catenin activation and drives the differentiation of fibroblasts into myofibroblasts [3538]. Moreover, downregulation of Wnt inhibitors such as DKK stabilizes β-catenin, thereby amplifying the fibrotic response [12, 39]. Additional signaling routes, such as Hedgehog, converge with Wnt/β-catenin to drive the mesenchymal stem cells differentiation into myofibroblasts [40, 41]. Collectively, these findings underscore that β-catenin acts not only as an “executor” of fibrosis but also as a key node integrating multiple signaling pathways. Existing studies agree that β-catenin remains continuously activated in the lungs of IPF patients, rather than being a transient stress response. Therefore, investigating the upstream factors or regulatory mechanisms of this pathway is crucial. In our study, we identified and characterized the transcription factor C/EBPγ as a key regulator of β-catenin stability. Specifically, C/EBPγ enhances β-catenin stability by downregulating AXIN1, thereby promoting its nuclear translocation and activates downstream fibrotic signaling. This mechanism aligns with the classical regulatory pattern of the Wnt/β-catenin pathway and also uncovers a potential new intervention point for the transcription factor family within this signaling axis. Notably, AXIN1, in addition to being a component of the β-catenin degradation complex, contains its own NES sequence, which functions as a molecular chaperone to promote the nuclear export of β-catenin [42, 43]. Thus, C/EBPγ-mediated downregulation of AXIN1 not only impairs the function of the degradation complex but also restricts the nuclear export of β-catenin, further enhancing its nuclear accumulation. This is consistent with the observation of β-catenin localization in the nucleus following C/EBPγ overexpression, as seen in immunofluorescence experiments. This mechanism supports the functional loop of the C/EBPγ-AXIN1-β-catenin axis at the cellular level, providing additional evidence for the enhanced β-catenin signaling and its fibrotic effects. This discovery not only broadens the regulatory network of Wnt/β-catenin in IPF but also offers a new perspective for understanding its pathogenesis and developing more targeted therapeutic strategies.
Members of the C/EBP family have been identified as critical regulators in fibrosis across different organs. For instance, in liver fibrosis, they regulate the expression of inflammatory factors and activation of hepatic stellate cells [44, 45]; in renal fibrosis, they influence EMT, FMT and ECM deposition; and in cardiac fibrosis, they are involved in cardiomyocyte reprogramming and collagen synthesis. Current research indicates that the involvement of this family in IPF is diverse and context dependent. Aside from C/EBPγ, other members have been widely studied: for example, C/EBPα primarily exerts a protective role in epithelial cells by inhibiting TGF-β signaling and upregulating cell cycle-related genes, thereby reducing EMT and fibroblast activation [46, 47]; in fibroblasts and macrophages, C/EBPβ activates the NF-κB pathway, promoting the expression of pro-inflammatory factors (such as IL-6, TNF-α) and ECM synthesis, thus exacerbating the fibrotic process [48, 49]; C/EBPδ plays a region- and cell type–specific dual role in pulmonary fibrosis—promoting fibrosis in alveolar epithelial cells and macrophages by inducing IL-6 and MCP-1 [50, 51], while suppressing it in Clara cells through upregulation of the protective proteins CCSP and SCGB3A2 [5255]; C/EBPζ (CHOP) serves as an essential regulator of endoplasmic reticulum stress, driving type II alveolar epithelial cell apoptosis via an IRE1α/PERK-dependent pathway; its loss markedly alleviates fibrosis induced by hypoxia or repeated epithelial injury [56, 57]. These results underscore the multifaceted functions of the C/EBP family in various cell types involved in IPF—such as lung epithelial cells, fibroblasts, and immune cells—and their participation in multiple signaling pathways, including TGF-β, NF-κB, and HIF-1α. These insights are crucial for understanding the regulatory network of fibrosis. In our study, we found that elevated expression of C/EBPγ stimulated β-catenin signaling, which in turn promoted fibrotic progression. While some existing studies support the protective role of C/EBPγ in inflammation and aging, our experimental results offer a novel insight into the role of C/EBPγ in fibrosis. In this study, we employed several methods to investigate the impact of C/EBPγ on the β-catenin pathway. We observed that overexpression of C/EBPγ in both A549 and MRC-5 cells resulted in increased β-catenin protein levels and significant nuclear translocation, thereby verifying the β-catenin activation. The use of agonists and inhibitors further validated the dependence of this effect on the β-catenin pathway. Additionally, the regulation of AXIN1 by C/EBPα and the interaction between C/EBPγ and C/EBPα strengthened this evidence. We believe that these findings do not contradict existing studies but rather enhance our understanding of the diverse roles of C/EBP family members. For instance, C/EBPβ, a member of this family, is predominantly associated with pro-inflammatory and pro-fibrotic effects [48, 49], although some studies have also shown its inhibitory role in the β-catenin pathway [58]. Transcription factors typically regulate multiple target genes, forming cell type–dependent multidimensional regulatory networks. These networks can modulate both protective and pathogenic pathways under various physiological and pathological conditions, suggesting that their functions may be bidirectional. C/EBPγ’s structure and function distinguish it from other transcription factors in terms of its mode of transcriptional regulation. It interacts with other family members to fine-tune their transcriptional efficiency [17, 59]. In addition, C/EBPγ can interact with other bZIP-containing transcription factors, such as ATF4 [19]. This broadens the scope of C/EBPγ's role, potentially altering gene expression governed by both family-related and external transcription factors. Therefore, investigating C/EBPγ's diverse functions under various conditions not only broadens our understanding of the C/EBP family, but also deepens our knowledge of disease mechanisms and may help in developing more targeted therapeutic strategies.
Despite systematically demonstrating the pro-fibrotic role of C/EBPγ in IPF and its underlying mechanisms in both in vitro and in vivo models, several limitations should be noted. First, the study largely relied on the bleomycin-induced murine model and classical in vitro systems such as A549 and MRC-5 cells. While these models are widely used and experimentally tractable, they do not fully capture the heterogeneity, chronic progression, and multifactorial interactions characteristic of human IPF, including patient-specific variability. Second, our data reveal the C/EBPγ–C/EBPα heterodimer as a critical regulator of the AXIN1–β-catenin axis and underscore the central role of β-catenin signaling in C/EBPγ-mediated profibrotic effects. However, the broader effects of disrupting this heterodimer on pathways beyond β-catenin warrant further investigation, as well as its potential interactions with other family members (such as C/EBPδ) or additional coregulatory factors, including epigenetic modifiers. This inherent complexity may constrain a comprehensive understanding of the dynamic regulatory networks orchestrated by the C/EBP family. Third, although AAV-mediated in vivo modulation of C/EBPγ confirmed its functional impact, questions regarding long-term safety, dose optimization, and potential off-target effects remain unresolved. These limitations highlight important directions for future research, including validation in patient cohorts and integrative multi-omics profiling, which will be crucial for advancing our comprehension of the transcriptional regulatory landscape in IPF. Moreover, the development of strategies targeting specific heterodimer interfaces within defined pathological stages or cellular subpopulations may provide a promising avenue, aligning closely with the core principle of precision medicine: targeted interventions with maximal specificity.
This study uncovers a pro-fibrotic role of C/EBPγ in Bleomycin-induced pulmonary fibrosis: C/EBPγ forms a nonfunctional heterodimer with C/EBPα that suppresses AXIN1, leading to activation of the β-catenin pathway and promoting EMT, fibroblast activation, and ECM deposition. These findings not only contribute significantly to the understanding of the C/EBP family in fibrotic networks but also provide new insights into IPF pathogenesis. Looking forward, integrative multi-omics validation and strategies targeting specific dimerization interfaces may enable the development of novel precision therapies and accelerate translational progress in IPF management.
Data availability
Data and material will be made available on request.
A
Acknowledgements
This research was financially supported by the Ministry of Science and Technology of the People’s Republic of China, the Science and Technology Department of Henan Province, and the Science and Technology Bureau of Xinxiang City. We are grateful for their generous funding, which has greatly contributed to the successful completion of this study.
A
Funding
This work was supported by the Ministry of Science and Technology, PR China grant 2019YFE0119500; Key R&D Program of Henan province grant 231111310400; Zhongyuan scholar 244000510009; Henan Project of Science and Technology grants 232102521025, GZS2023008 and 242102310157.
Author information
Authors and Affiliations
State Key Laboratory of Cell Differentiation and Regulation, Henan International Joint Laboratory of Pulmonary Fibrosis, Henan Center for Outstanding Overseas Scientists of Organ Fibrosis, Pingyuan Lab, College of Life Science, Henan Normal University, Xinxiang 453007, China
Xiaoyue Pan, Yulong Gan, Ying Cao, Man Zhao, Cong Xia, Huibing Liu, Yanlin Zhou, Yuqi Wang, Zhongzheng Li, Bin Li, Lan Wang, Guoying Yu.
A
Author contributions
Conceptualization: G.Y., L.W., X.P.. X.P. designed and conducted the experiments, and drafted the manuscript with the assistance of Y.G., Y.C., M.Z., Y.Z., Y.W., C.X., H.L., B.L.. X.P., Y.G., Y.C., M.Z. and Y.Z. performed animal experiments. X.P., Y.G., Y.C., M.Z. and Y.Z. analyzed the data, organized data for presentation. All authors read and approved the final version of the manuscript.
Corresponding authors
Correspondence to Lan Wang or Guoying Yu.
A
Ethics declarations
Ethics approval and consent to participate
All animal maintenance and experimental procedures were conducted in accordance with the guidelines of the Institutional Animal Care and Use Committee of Henan Normal University (IACUC, SMKX-2118BS1018), which comply with the standards of the Association for Animal Behavior and national regulations. Lung tissue samples from patients with idiopathic pulmonary fibrosis (IPF) and non-IPF controls were collected at Henan Provincial Chest Hospital following the ATS/ERS/JRS/ALAT Clinical Practice Guidelines. The study protocol was approved by the Medical Research Ethics Committee of Henan Provincial Chest Hospital (No. 2019-05-07), and written informed consent was obtained from all participants prior to surgery. All procedures involving human subjects were performed in accordance with the ethical standards of the World Medical Association Declaration of Helsinki.
Competing interests
The authors declare that they have no conflicts of interest concerning the contents of this article.
Consent for publication
All authors reviewed the results and contributed to the final manuscript. All authors approved this manuscript for publication.
Electronic Supplementary Material
Below is the link to the electronic supplementary material
References
1.
Richeldi L, Collard HR, Jones MG (2017) Idiopathic pulmonary fibrosis. Lancet 389:1941–1952
2.
David JL, Fernando JM (2018) Idiopathic Pulmonary Fibrosis. N Engl J Med ; 378
3.
John H, Andrew F, Richard H, Tricia M (2015) Global incidence and mortality of idiopathic pulmonary fibrosis: a systematic review. Eur Respir J ; 46
4.
Chunxue B, Sanjay HC, Jordi R, George AA, Leo CG, Jerry AK et al (2020) Updated guidance on the management of COVID-19: from an American Thoracic Society/European Respiratory Society coordinated International Task Force (29 July 2020). Eur Respir Rev ; 29
5.
Ganesh R, Martine R-J, Jeffrey LM, Luca R, Christopher JR, David JL et al (2018) Diagnosis of Idiopathic Pulmonary Fibrosis. An Official ATS/ERS/JRS/ALAT Clinical Practice Guideline. Am J Respir Crit Care Med ; 198
6.
Paolo S, Jonathan AK, Mark GJ, Joyce SL, Giulio R, Theodoros K et al (2020) Idiopathic pulmonary fibrosis: Disease mechanisms and drug development. Pharmacol Ther ; 222
7.
Luca R, Roland M, dB, Ganesh R, Arata A, Kevin KB, Ulrich C et al (2014) Efficacy and safety of nintedanib in idiopathic pulmonary fibrosis. N Engl J Med ; 370
8.
Talmadge E Jr, Williamson K, Socorro ZB, Elizabeth C-B, Ian AF, Marilyn G (2014) K G, A phase 3 trial of pirfenidone in patients with idiopathic pulmonary fibrosis. N Engl J Med ; 370
9.
Borja GC, Hanaa S, Mar M, Amanda I, Cristina G, Nuria T-P et al (2023) Redefining the Role of Bronchoscopy in the Workup of Severe Uncontrolled Asthma in the Era of Biologics: A Prospective Study. Chest ; 164
10.
Moss BJ, Ryter SW, Rosas IO (2022) Pathogenic Mechanisms Underlying Idiopathic Pulmonary Fibrosis. Annu Rev Pathol 17:515–546
11.
Rius Rigau A, Dees C (2024) Mechanisms of Fibroblast Activation during Fibrotic Tissue Remodeling. Fibrosis 2:10002
12.
Jiaqi L, Qing X, Jiani X, Chenxi N, Yuanyuan L, Xiaojun Z et al (2022) Wnt/β-catenin signalling: function, biological mechanisms, and therapeutic opportunities. Signal Transduct Target Ther ; 7
13.
Chilosi M, Poletti V, Zamo A, Lestani M, Montagna L, Piccoli P et al (2003) Aberrant Wnt/beta-catenin pathway activation in idiopathic pulmonary fibrosis. Am J Pathol 162:1495–1502
14.
William R Jr, Emil H, Xin YC, Cu Y, Ying-tzang N, Beiyun T et al (2010) Z,. Inhibition of Wnt/beta-catenin/CREB binding protein (CBP) signaling reverses pulmonary fibrosis. Proc Natl Acad Sci U S A. ; 107
15.
Wang L, Zhao W, Xia C, Ma S, Li Z, Wang N et al (2023) TRIOBP modulates beta-catenin signaling by regulation of miR-29b in idiopathic pulmonary fibrosis. Cell Mol Life Sci 81:13
16.
Dipak PR, Pelagia F (2002) CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J ; 365
17.
Huggins CJ, Malik R, Lee S, Salotti J, Thomas S, Martin N et al (2013) C/EBPgamma suppresses senescence and inflammatory gene expression by heterodimerizing with C/EBPbeta. Mol Cell Biol 33:3242–3258
18.
Renfro Z, White BE, Stephens KE (2022) CCAAT enhancer binding protein gamma (C/EBP-gamma): An understudied transcription factor. Adv Biol Regul 84:100861
19.
Huggins CJ, Mayekar MK, Martin N, Saylor KL, Gonit M, Jailwala P et al (2015) C/EBPgamma Is a Critical Regulator of Cellular Stress Response Networks through Heterodimerization with ATF4. Mol Cell Biol 36:693–713
20.
Meritxell A-J, Bas W, Martin B, Clara S-K, Hong Z, Annalisa DR et al (2012) C/EBPγ deregulation results in differentiation arrest in acute myeloid leukemia. J Clin Invest ; 122
21.
Roberta M, Gabriella B, Marta R, Stefania S, Antonia G, Anna DC et al (2012) C/EBPγ regulates wound repair and EGF receptor signaling. J Invest Dermatol ; 132
22.
Yan C, Zhang L, Yang L, Zhang Q, Wang X (2020) C/EBPgamma is a critical negative regulator of LPS-/IgG immune complex-induced acute lung injury through the downregulation of C/EBPbeta-/C/EBPdelta-dependent C/EBP transcription activation. FASEB J 34:13696–13710
23.
Yan C, Wang X, Cao J, Wu M, Gao H (2012) CCAAT/enhancer-binding protein gamma is a critical regulator of IL-1beta-induced IL-6 production in alveolar epithelial cells. PLoS ONE 7:e35492
24.
Yu G, Tzouvelekis A, Wang R, Herazo-Maya JD, Ibarra GH, Srivastava A et al (2017) Thyroid hormone inhibits lung fibrosis in mice by improving epithelial mitochondrial function. Nat Med 24:39–49
25.
Harold RC, Christopher JR, Tamera JC, Gisli J, Yasuhiro K, David JL et al (2016) Acute Exacerbation of Idiopathic Pulmonary Fibrosis. An International Working Group Report. Am J Respir Crit Care Med ; 194
26.
Xinya W, Xinrui X, Yihan H, Huaizhe Z, Wenyang H, Jianqi S et al (2025) Diagnosis of early idiopathic pulmonary fibrosis: current status and future perspective. Respir Res ; 26
27.
Raghu G, Ghazipura M, Fleming TR, Aronson KI, Behr J, Brown KK et al (2024) Meaningful Endpoints for Idiopathic Pulmonary Fibrosis (IPF) Clinical Trials: Emphasis on 'Feels, Functions, Survives'. Report of a Collaborative Discussion in a Symposium with Direct Engagement from Representatives of Patients, Investigators, the National Institutes of Health, a Patient Advocacy Organization, and a Regulatory Agency. Am J Respir Crit Care Med. ; 209: 647 – 69
28.
Wei S, Yingying G, Qianqian W, Lu M, Qing Z, Yuhan Z et al (2024) YAP1 inhibits the senescence of alveolar epithelial cells by targeting Prdx3 to alleviate pulmonary fibrosis. Exp Mol Med ; 56
29.
Roxana W, Martina K, Katarzyna P, Ingrid H, Jochen W, Poornima M et al (2022) Notch1 Induces Defective Epithelial Surfactant Processing and Pulmonary Fibrosis. Am J Respir Crit Care Med ; 207
30.
Pierre-Marie B, Olivier B, Guillaume B, Pierre-Simon B, Lucile D, Guillaume M et al (2020) TRIM33 prevents pulmonary fibrosis by impairing TGF-β1 signalling. Eur Respir J ; 55
31.
Fenghua B, Ying-Wei L, Shuyang Z, Zicheng D, Samriddhi S, Anusha A et al (2023) Lung endothelial cells regulate pulmonary fibrosis through FOXF1/R-Ras signaling. Nat Commun ; 14
32.
Melanie K, Nisha B, Eva-Maria P, Monika K, Izabella C, Werner S et al (2008) Functional Wnt signaling is increased in idiopathic pulmonary fibrosis. PLoS ONE ; 3
33.
Tae Hyung K, Sang-Heon K, Ji-Young S, Hana C, Hyun Jung K, Sang-Kyung L et al (2011) Blockade of the Wnt/β-catenin pathway attenuates bleomycin-induced pulmonary fibrosis. Tohoku J Exp Med ; 223
34.
Anna PL, Jose D H-M, Joseph AS, Annette SF, Susan R, Gökhan MM et al (2014) Wnt coreceptor Lrp5 is a driver of idiopathic pulmonary fibrosis. Am J Respir Crit Care Med ; 190
35.
Hoeke AB, Anita IRS, Gertruud H, Lilian HJME, Herman M, Marnix RJ et al (2011) Activation of WNT/β-catenin signaling in pulmonary fibroblasts by TGF-β₁ is increased in chronic obstructive pulmonary disease. PLoS ONE ; 6
36.
Filippo C, Elisa G, Marco C, Marco F, Cristina LR, Nunzio C et al (2008) TGF-beta1 targets the GSK-3beta/beta-catenin pathway via ERK activation in the transition of human lung fibroblasts into myofibroblasts. Pharmacol Res ; 57
37.
Edyta D, Marcin C, Karolina T, Maciej S, Gabriela K, Przemysław B (2021) WNT/β-Catenin Signaling Promotes TGF-β-Mediated Activation of Human Cardiac Fibroblasts by Enhancing IL-11 Production. Int J Mol Sci ; 22
38.
Alexandre V, Yves L, Rémy G, Jean-Noël V (2017) Interactions between TGF-β1, canonical WNT/β-catenin pathway and PPAR γ in radiation-induced fibrosis. Oncotarget ; 8
39.
Alfiya A, Katrin P, Clara D, Christina B, Paulius V, Pawel Z et al (2012) Activation of canonical Wnt signalling is required for TGF-β-mediated fibrosis. Nat Commun ; 3
40.
Xiang C, Chaowen S, Honghui C, Ling C, Jiwei H, Zou X et al (2018) The hedgehog and Wnt/β-catenin system machinery mediate myofibroblast differentiation of LR-MSCs in pulmonary fibrogenesis. Cell Death Dis ; 9
41.
Kugler MC, Loomis CA, Zhao Z, Cushman JC, Liu L, Munger JS (2017) Sonic Hedgehog Signaling Regulates Myofibroblast Function during Alveolar Septum Formation in Murine Postnatal Lung. Am J Respir Cell Mol Biol 57:280–293
42.
Feng C, Harold V (2004) Nuclear-cytoplasmic shuttling of Axin regulates subcellular localization of beta-catenin. Proc Natl Acad Sci U S A ; 101
43.
Qiu L, Sun Y, Ning H, Chen G, Zhao W, Gao Y (2024) The scaffold protein AXIN1: gene ontology, signal network, and physiological function. Cell Commun Signal 22:77
44.
Akanksha S, Alok KV, Matthew K, Ramesh K, Alexander M, Tong W et al (2020) Lipopolysaccharide Reverses Hepatic Stellate Cell Activation Through Modulation of cMyb, Small Mothers Against Decapentaplegic, and CCAAT/Enhancer-Binding Protein C/EBP Transcription Factors. Hepatology ; 72
45.
Lian L, Shuang P, Mengyun D, Cuiliu L, Lingrui L, Xing Z et al (2021) The role of C/EBP homologous protein (CHOP) in regulating macrophage polarization in RAW264.7 cells. Microbiol Immunol ; 65
46.
Liu W, Meridew JA, Aravamudhan A, Ligresti G, Tschumperlin DJ, Tan Q (2019) Targeted regulation of fibroblast state by CRISPR-mediated CEBPA expression. Respir Res 20:281
47.
Sato A, Xu Y, Whitsett JA, Ikegami M (2012) CCAAT/enhancer binding protein-alpha regulates the protease/antiprotease balance required for bronchiolar epithelium regeneration. Am J Respir Cell Mol Biol 47:454–463
48.
El Kasmi KC, Pugliese SC, Riddle SR, Poth JM, Anderson AL, Frid MG et al (2014) Adventitial fibroblasts induce a distinct proinflammatory/profibrotic macrophage phenotype in pulmonary hypertension. J Immunol 193:597–609
49.
Liu SS, Lv XX, Liu C, Qi J, Li YX, Wei XP et al (2019) Targeting Degradation of the Transcription Factor C/EBPbeta Reduces Lung Fibrosis by Restoring Activity of the Ubiquitin-Editing Enzyme A20 in Macrophages. Immunity ; 51: 522 – 34 e7.
50.
Chunguang Y, Chunmin D, Xiufang L, Yutong C, Jiawei Y, Rentian C et al (2018) TNF-α induction of IL-6 in alveolar type II epithelial cells: Contributions of JNK/c-Jun/AP-1 element, C/EBPδ/C/EBP binding site and IKK/NF-κB p65/κB site. Mol Immunol ; 101
51.
Chunguang Y, Bingyu L, Xiufang L, Chunming D, Rentian C, Yanfei S et al (2019) Involvement of multiple transcription factors in regulation of IL-β-induced MCP-1 expression in alveolar type II epithelial cells. Mol Immunol ; 111
52.
T N C, L N-M OA, J A G MN (2000) C/EBPalpha and C/EBPdelta activate the clara cell secretory protein gene through interaction with two adjacent C/EBP-binding sites. Am J Respir Cell Mol Biol ; 22
53.
Takeshi T, Taketomo K, Reiko K, Shun-Ichiro I, Esta S, Tohru N et al (2008) CAATT/enhancer-binding proteins alpha and delta interact with NKX2-1 to synergistically activate mouse secretoglobin 3A2 gene expression. J Biol Chem ; 283
54.
Tove B, Tobias NC, Per ES, Magnus N (2002) Glucocorticoids regulate the CCSP and CYP2B1 promoters via C/EBPbeta and delta in lung cells. Biochem Biophys Res Commun ; 293
55.
Yan C, Shioko K (2015) Secretoglobin 3A2 Exhibits Anti-Fibrotic Activity in Bleomycin-Induced Pulmonary Fibrosis Model Mice. PLoS ONE ; 10
56.
Eva D, Abdoulaye S, Adnan N, Rabab L, Olivier B, Alain B et al (2018) HIF-1α triggers ER stress and CHOP-mediated apoptosis in alveolar epithelial cells, a key event in pulmonary fibrosis. Sci Rep ; 8
57.
Burman A, Kropski JA, Calvi CL, Serezani AP, Pascoalino BD, Han W et al (2018) Localized hypoxia links ER stress to lung fibrosis through induction of C/EBP homologous protein. JCI Insight ; 3
58.
Park S, Lee MS, Gwak J, Choi TI, Lee Y, Ju BG et al (2018) CCAAT/enhancer-binding protein-beta functions as a negative regulator of Wnt/beta-catenin signaling through activation of AXIN1 gene expression. Cell Death Dis 9:1023
59.
Parkin SE, Baer M, Copeland TD, Schwartz RC, Johnson PF (2002) Regulation of CCAAT/enhancer-binding protein (C/EBP) activator proteins by heterodimerization with C/EBPgamma (Ig/EBP). J Biol Chem 277:23563–23572
Figures with the corresponding legend
A
A
Fig. 8
Schematic illustrating the mechanism of C/EBPγ in pulmonary fibrosis
Left: When C/EBPγ expression is low, C/EBPα exerts its anti-fibrotic effects by promoting AXIN1 transcription, leading to β-catenin phosphorylation and degradation, thereby inhibiting β-catenin signaling activation, reducing epithelial-mesenchymal transition (EMT) and fibroblast activation, and alleviating pulmonary fibrosis.
Right: When C/EBPγ expression is high, it forms heterodimers with C/EBPα to suppress AXIN1 transcription, resulting in β-catenin dephosphorylation, stabilization, and nuclear translocation, activating β-catenin signaling, promoting EMT and fibroblast activation, and exacerbating pulmonary fibrosis.
Click here to Correct
Table
Click here to Correct
Supplementary Fig. 1 C/EBPα overexpression attenuates upregulation of fibrotic markers induced by β-catenin activation in MRC-5 cells.
(A)
Immunofluorescence staining showing the effect of C/EBPα overexpression on Collagen I, fibronectin and α-SMA expression in MRC-5 cells treated with the β-catenin agonist HLY78. Scale bars: 20 µm.
Click here to Correct
Supplementary Fig. 2. C/EBPγ ΔbZIP construction and its effect on fibrotic markers in MRC-5 cells.
(A)
Schematic diagram showing the construction of the C/EBPγ ΔbZIP truncation lacking the bZIP domain.
(B)
Western blot analysis showing the effects of C/EBPγ ΔbZIP on fibronectin and α-SMA expression in MRC-5 cells in the presence or absence of HLY78.
Total words in MS: 7324
Total words in Title: 13
Total words in Abstract: 0
Total Keyword count: 5
Total Images in MS: 10
Total Tables in MS: 1
Total Reference count: 59