First identification of Sarcocystis medusiformis in Chinese sheep (Ovis aries): Morphological and molecular characterization
Danqu Lamu 1
Luyao Qian 2
Zhun Hu 2
Lu Xu 3
Shuangsheng Deng 3
Jianping Tao 4
Yurong Yang 5
Junjie Hu 2✉ Email
1 Institute of Animal Science Tibet Academy of Agricultural and Animal Husbandry Sciences 850009 Lhasa China
2 Yunnan Key Laboratory for Plateau Mountain Ecology, Restoration of Degraded Environments, School of Ecology and Environmental Sciences Yunnan University 650091 Kunming China
3 Joint Laboratory of Virology & Immunity, School of Biological Sciences Yunnan University 650091 Kunming China
4 College of Veterinary Medicine Yangzhou University 225009 Yangzhou China
5 College of Veterinary Medicine Henan Agricultural University 450046 Zhengzhou China
Danqu Lamu1, Luyao Qian2, Zhun Hu2, Lu Xu3, Shuangsheng Deng3, Jianping Tao4, Yurong Yang5, and Junjie Hu2*
1 Institute of Animal Science, Tibet Academy of Agricultural and Animal Husbandry Sciences, Lhasa 850009, China
2 Yunnan Key Laboratory for Plateau Mountain Ecology, Restoration of Degraded Environments, School of Ecology and Environmental Sciences, Yunnan University, Kunming 650091, China
3 Joint Laboratory of Virology & Immunity, School of Biological Sciences, Yunnan University, Kunming 650091, China
4 College of Veterinary Medicine, Yangzhou University, Yangzhou 225009, China
5 College of Veterinary Medicine, Henan Agricultural University, Zhengzhou 450046, China
*Corresponding author: jjhu@ynu.edu.cn.
A
Abstract -
This study reports the first detection of Sarcocysits medusiformis in sheep (Ovis aries) in China through integrated morphological and molecular analysis. Macroscopically visible S. medusiformis sarcocysts were found in 4 of 92 examined sheep (4.3%), measuring 2490–4796 × 248–405 µm and exhibiting thin, striated walls (1–2 µm thick). Ultrastructural examination revealed trapezoidal villar protrusions covering the cysts, each lined with an electron-dense layer, with scattered microtubes extending from the apex to the base. Molecular characterization was performed by amplifying and sequencing four genetic markers (18S rRNA, 28S rRNA, ITS-1, and mitochondrial cox1). The newly obtained 18S rRNA, 28S rRNA and cox1 sequences exhibited 100% identify with previously published S. medusiformis sequences in GenBank. Phylogenetic analysis based on these sequences consistently grouped S. medusiformis, S. gigantea, and S. moulei within a distinct clade. To date, S. medusiformis sarcocysts have been documented primarily in sheep, with a single known case in an addax (Addax nasomaculatus). Further investigations involving expanded sampling of wild and domestic bovid ruminants are needed to clarify the epidemiology, host specificity, and phylogenetic relationships of S. medusiformis and morphologically similar species.
Keywords:
Sarcocysits medusiformis
Ovis aries
Morphology
Phylogeny
China
Introduction
Sarcocystis spp. are cyst-forming, intracellular protozoan parasites with an obligate two-host life cycle based on a prey-predator relationship. Sexual reproduction occurs in the intestinal epithelial cells of carnivorous definitive hosts, leading to the excretion of oocysts or sporocysts. In herbivorous intermediate hosts, asexual replication results in the formation of intramuscular sarcocysts (Dubey et al. 2016). Sheep (Ovis aries) are intermediate hosts for at least nine Sarcocystis species, including S. tenella (Moulé 1886), S. gigantea (Ashford 1977), S. medusiformis (Collins et al. 1979), S. arieticanis (Heydorn 1985), S. microps (Wang et al. 1988), S. cystiformis (Wang et al. 1989). S. mihoensis (Saito et al. 1997), S. gracilis-like (Giannetto et al. 2005)d mihoensis-like (Gjerde et al. 2020), which are primarily differentiated by their sarcocyst wall ultrastructure. Notably, only S. gigantea and S. medusiformis develop macroscopically visible sarcocysts, informally categorized by their gross morphology as "fat" and "thin" cysts, respectively (Collins et al. 1979). Natural Sarcocystis infections in sheep can induce significant clinical pathology, including weight loss, abortion, myocarditis, encephalitis, and in severe cases, acute mortality (Railliet 1886; Dubey et al. 1989; Scott and Sargison 2001; Yaziroglu and Beyazit 2005). Moreover, the presence of macrocysts formed by S. gigantea and S. medusiformis, along with associated eosinophilic myositis, frequently leads to partial or complete carcass condemnation, incurring substantial economic losses in both lamb and adult sheep production (Collins 1980; Ezzi et al. 1992).
Among the Sarcocystis species infecting sheep, S. tenella, S. arieticanis, and S. gigantea are globally distributed (Dubey et al. 2016; Feng et al. 2023). In contrast, reports of S. medusiformis have been more geographically restricted, with confirmations limited to New Zealand (Collins et al. 1979), Australia (O'Donoghue and Ford 1986; Obendorf and Munday 1987), Iran (Farhang-Pajuh et al. 2014), Iraq (Nawshirwan et al. 2023), Italy (Pipia et al. 2016), Egypt (El-Morsey et al. 2021), and Spain (Gjerde et al. 2020; Peris et al. 2024). This study reports the first detection of S. medusiformis in Chinese sheep, confirmed through comprehensive morphological analysis. To further characterize this isolate and clarify its phylogenetic position among ruminant-infecting Sarcocystis species, we performed molecular characterization by sequencing and analyzing four genetic markers: the 18S rRNA, 28S rRNA, and mitochondrial cox1 genes, and the ITS-1 region.
Materials and methods
Morphological observation of sarcocysts
A
Muscle tissues were collected from 92 sheep between July and December 2024 at three abattoirs in southwestern China (two in Lhasa city and one in Kunming city). From each animal, fresh specimens of diaphragm, skeletal muscle, and cardiac tissue were obtained and examined for the presence of sarcocysts. In the laboratory, small sections of muscle were compressed between glass slides. Sarcocysts were initially detected using a stereomicroscopy (Leica MZ6). Individual sarcocysts were then meticulously isolated from muscle tissue under magnification using dissecting needles for subsequently light microscopy (LM), transmission electron microscopy (TEM), and DNA extraction.
LM observation was performed using an Olympus BX51 microscope. For TEM examination, isolated sarcocysts were initially fixed in 2.5% glutaraldehyde dissolved in 0.1 M cacodylate buffer (pH 7.4) at 4°C, followed by post-fixed in 1.0% osmium tetroxide using the same buffer. Samples were then dehydrated through a graded ethanol series (30–100%) and embedded in Epon-Araldite resin. Ultrathin sections (70–90 nm) were double-stained with uranyl acetate (35 mg/ml) and lead citrate (35 mg/ml), and examined using a JEM100-CX TEM (JEOL Ltd., Tokyo, Japan) operating at 80 kV.
DNA extraction and molecular characterization
Individual cysts preserved in sterile distilled water at − 20°C were used for genetic DNA extraction. DNA was extracted from three sarcocysts (each from a different sheep) using the TIANamp Genomic DNA Kit (Tiangen Biotech Ltd., Beijing, China) according to the manufacturer’s instructions. Four genetic markers–18S rRNA, 28S rRNA, ITS-1, and mitochondrial cox1– were amplified from each sarcocyst using the primers specified in Table 1.
A
PCR was performed in a 25-µL reaction mixture containing: 1X PCR buffer, 0.15 mM MgCl₂, 0.25 mM dNTPs, 1 U of Taq DNA polymerase (TaKaRa, Dalian, China), 50–100 ng of template DNA, and 25 pmol of each primer. Amplification was carried out in a Bio-Rad T100 thermal cycler with the following program: initial denaturation at 95°C for 5 min; 35 cycles of 94°C for 1 min, 53–57°C (primer-specific) for 1 min, and 72°C for 1 min; followed by a final extension at 72°C for 10 min. PCR products were purified using the E.Z.N.A.® Gel Extraction Kit (Omega Bio-Tek, Inc., USA), ligated into the pCE2 TA/Blunt-Zero vector (5 min TA/Blunt-Zero Cloning Kit, Vazyme Biotech Co., Ltd., Nanjing, China), and transformed into Trelief™ 5α Chemically Competent Cells (Tsingke Biotechnology Co., Ltd., Beijing, China). Positive clones were sequenced bidirectionally on an ABI PRISM™ 3730 XL DNA Analyzer (Applied Biosystems, USA).
Table 1
Primers used for the amplification of the four DNA regions
DNA region
Primer name
Primer sequences (5′–3′)
References
18S rRNA
ERIB1a
ACC TGG TTG ATC CTG CCA G
Barta et al.1997
PrimerBb
GATCCTTCTGCAGGTTCACCTAC
Fenger et al. 1995
28S rRNA
KL1a
TACCCGCTGAACTTAAGC
Mugridge et al. 2000
KL3b
CCACCAAGATCTGCACTAG
KL4 a
AGCAGGACGGTGGTCATG-
KL5b
CTCAAGCTCAACAGGGTC
KL6a
GGATTGGCTCTGAGGG
KL2b
ACTTAGAGGCGTTCAGTC
ITS-1
SU1Fa
GATTGAGTGTTCCGGTGAATTATT
Gjerde 2014a
5.8SR2b
AAGGTGCCATTTGCGTTCAGAA
cox1
SF1a
ATGGCGTACAACAATCATAAAGAA
Gjerde 2013
SR9b
ATATCCATACCRCCATTGCCCAT
Gjerde 2013b
aforward primer; breverse primer
The obtained sequences were assembled using the SeqMan II program (DNASTAR, USA) based on multiple overlapping regions. Sequence identity and similarity analyses were performed using BioEdit software (Hall 1999). Initial characterization was conducted by comparing the sequences against the GenBank database using the online BLASTn tool (National Center for Biotechnology Information, NIH, USA).
Phylogenetic analysis
Phylogenetic analyses were conducted separately on the nucleotide sequences of the 18S rRNA, 28S rRNA, and mitochondrial cox1 using MEGA 11 software (Tamura et al. 2021). Reference sequences of Sarcocystis spp. for each gene were retrieved from GenBank. The 18S rRNA and 28S rRNA sequences were aligned using the “R-Coffee” web server, which integrates predicted secondary RNA structure to enhance alignment accuracy (Di Tommaso et al. 2011). The mitochondrial cox1 sequences were aligned using the MUSCLE algorithm embedded in the MEGA 11. All alignments were manually inspected and trimmed at both ends to guarantee uniform start and stop positions across all sequences. The final aligned datasets were as follows: the aligned 18S rRNA nucleotide sequences (24 sequences from 23 species) comprised 1944 positions, ranging from position 60 to 1853 of S. gigantea (MK420020); the aligned 28S rRNA nucleotide sequences (21 sequences from 20 species) consisted of 1831 positions, ranging from position 1 to 1641 of S. gigantea (U85706); and the aligned cox1 nucleotide sequences (22 sequences from 20 species) consisted of 1020 positions, ranging from position 1 to 1020 of S. gigantea (MK420012) without any gaps.
Maximum likelihood (ML) phylogenetic trees were constructed for the 18S rRNA, 28S rRNA, and mitochondrial cox1 sequences using the Tamura 3-parameter, Hasegawa-Kishino-Yano, and Kimura 2-parameter models, respectively. These models were selected based on the lowest BIC (Bayesian Information Criterion) and AICc (Akaike information Criterion, corrected) values determined through ML analysis implemented in MEGA11. All positions containing gaps and missing data were removed using the complete deletion option. The final datasets consisted of 1560 positions for 18S rRNA, 1440 positions for 28S rRNA, and 1020 positions for mitochondrial cox1. The reliability of the ML phylograms was assessed using the bootstrap method with 1000 replications. Toxoplasma gondii and Hammondia spp. were selected as outgroups to root the phylogenetic trees.
Results
Morphological characterization of S. medusiformis sarcocysts
Macroscopically visible sarcocysts (Fig. 1a) were detected in 4 out of 92 sheep (4.3%), exclusively localized in skeletal muscles and diaphragms, with no observed infection in cardiac tissue. Under LM, the sarcocysts measured 2490–4796 µm in length and 248–405 µm in width, exhibiting a thin (1–2 µm thick), striated cyst wall (Fig. 1b). Internally, septa subdivided the sarcocyst into compartments densely packed with banana-shaped bradyzoites measuring 15.3–18.6 × 3.4–4.2 µm (Fig. 1c).
Ultrastructural analysis further revealed that the cyst wall was covered with trapezoidal villar protrusions (VPs), each lined by a distinct electron-dense layer (Fig. 1d, e). These VPs measured 0.8–1.3 µm in length and contained scattered microtubes extending from the apex to the base, without penetrating the underlying ground substance layer (GSL) (Fig. 1e). The GSL was 2.0–2.3 µm thick. Additionally, coiled serpentine filaments were observed originating both the surfaces of the VPs and the intervening areas between them. These ultrastructure characteristics correspond to the type 20 cyst wall as defined by Dubey et al. (2016), confirming the identification of the parasite as S. medusiformis.
Fig. 1
Morphological characteristics of S. medusiformis sarcocysts in sheep under stereomicroscopy (a), light microscopy (LM, b and c) and transmission electron microscope (TEM, d and e). a, Macroscopically visible sarcocyst (S) in fresh muscle tissue. b, A detached sarcocyst separated from a myocyte. Note the thin, striated cyst wall (SCW, unstained). c, Banana-shaped bradyzoites spilled from a sarcocyst. d, Longitudinal section of a sarcocyst. Note trapezoidal villar protrusions (VP) on the cyst wall surface, the ground substance layer (GSL) beneath the cyst wall, and the densely packed bradyzoites (BZ) within the sarcocyst. e, Diagonal section of a sarcocyst. Note the surrounding host cell (HC), scattered microtubes (MT) within the VP, serpentine filaments (F) on the VP surface, and the GSL.
Click here to Correct
Molecular characteristics of S. medusiformis
Sequencing of three S. medusiformis sarcocysts isolates from different sheep yielded complete sequences for 18S rRNA (1928 bp), 28S rRNA (3468 bp), ITS-1 (602 bp) and partial cox1 (1085 bp). All 18S and 28S rRNA sequences showed 100% identity among isolates, while ITS-1 and cox1 exhibited near-identity, with sequences similarities of 99.7–100% and 99.0-100%, respectively. Representative nucleotide sequences have been deposited in GenBank database under the following accession numbers: PV460240 (18S rRNA), PV460246 (28S rRNA), PV470857 and PV470858 (ITS-1), PV468778 and PV468779 (cox1).
Comparison with existing sequences in GenBank (Table 2) revealed that the newly obtained 18S rRNA, 28S rRNA, and cox1 sequences showed the highest similarity (up to 100% identity) to S. medusiformis. The next closest matches were S. gigantea from sheep and S. moulei from goats. In contrast, BLAST analysis of the newly generated ITS-1 sequences showed no significant similarity to any entries currently available in GenBank.
Table 2
Similarities of nucleotide sequences between newly sequenced Sarcocystis medusiformis and those previously provided in GenBank
DNA regions
 
Similarity with those previously deposited in GenBank
Sarcocystis sp.
Accession numbers
% Coverage
% Similarity (on average)
18S rRNA
S. medusiformis
MK420021, MT705985
100
99.6–100 (99.8)
S. gigantea
MK420020, OP550293, MT705975, KC209733, L24384
96–100
95.8–96.7 (96.5)
S. moulei
L76473, OP430827, OP430830, OP430832, OP430834, OP430835
96
96.1–96.9 (96.5)
28S rRNA
S. medusiformis
MK420026, MT706454
100
99.6–100 (99.8)
S. gigantea
U85706
100
96.0
S. moulei
AF012884, OP429586, OP430799–OP430803
99–100
95.5–95.7 (95.6)
cox1
S. medusiformis
MK420014, MK420015, MT722971, MT722972
95
99.0–100 (99.5)
S. gigantea
MK420011–MK420013, MT722969, MT722970, KC209601, MK120979
89–95
87.6–88.1 (88.0)
Phylogenetic analysis
Phylogenetic analysis based on 18S rRNA (Fig. 2a), 28S rRNA (Fig. 2a) and mitochondrial cox1 (Fig. 2c) revealed revealed that the newly sequenced S. medusiformis isolates formed a well-supported clade with S. gigantea and S. moulei. These species infect sheep or goats, produce macroscopically visible cysts, and share felids as their definitive hosts. In the trees inferred from 18S rRNA and cox1 sequences, this S. medusiformis clade grouped with other macrocyst-forming, felid-definitive Sarcocystis species from large ruminants, including S. hirsute from cattle (Bos taurus) and S. buffalonis and S. fusiformis from water buffalo (Bubalus bubalis). In contrast, the topology of the 28S rRNA-based tree differed. Here, the S. medusiformis clade was placed within a larger group comprising Sarcocystis species that form microcysts and utilize canids as definitive hosts. This group included S. tenella and S. arieticanis in sheep, S. capracanis and S. hircicanis in goats, S. cruzi in cattle, and S. poephagicanis in yaks. Notably, the felid-associated, macrocyst-forming species from cattle and water buffalo (S. hirsuta, S. buffalonis, S. fusiformis) formed a basal group to this larger cluster in this particular phylogenetic reconstruction.
Fig. 2
Phylogenetic trees based on 18S rRNA (a), 28S rRNA (b) and cox1 (c) sequences. The trees were constructed using the Tamura 3-parameter (18S rRNA), Hasegawa-Kishino-Yano (28S rRNA), and Kimura 2-parameter model (cox1) The values between the branches represent bootstrap values per 1000 replicates, and values below 50% are not shown. The newly sequenced Sarcocystis medusiformis (shown in boldface) clusters with S. gigantea and S. moulei in a distinct clade.
Click here to Correct
Discussion
Railliet (1886) first described large, ovoid sarcocysts in sheep esophagi, naming them Sarcocystis (Balbiania) gigantea. Later, Mehlhorn and Scholtyseck (1973) provided the ultrastructural description of these sarcocysts, characterized by a thick, double-layered wall with numerous "cauliflower-like" protrusions. Nearly a century after the initial description, Collins et al. (1979) identified a distinct macroscopic sarcocyst in sheep skeletal muscle, distinguished by a thin primary cyst wall (< 2 µm) bearing "snake-like" projections on both the villar and inter-villar surface. Based on these unique morphological traits, it was designated S. medusiformis. In the present study, all observed macroscopic sarcocysts exhibited thin, striated primary cyst walls consistent with the ultrastructure of S. medusiformis originally described in New Zealand sheep (Collins et al. 1979). According to the classification system of Dubey et al. (2016), the cyst wall conforms to type 20.
Sarcocystis species in sheep exhibit a global distribution, with microcyst-forming species (utilizing canids as definitive hosts) being more prevalent than macrocyst-forming species (transmitted via felids) (Dubey et al. 2016; Feng et al. 2023). In China, both microcysts and macrocysts have been detected. Reported prevalence rates for microcysts range from 33.85% to 91.9% (Hu et al. 2017; Dong et al. 2018; Kang et al. 2024), while macrocysts have been reported at 29.1% (Sun et al. 2021). Previous morphological and molecular analyses in Chinese sheep have identified three species: S. tenella, S. arieticanis, and S. gigantea. Our team has previously characterized the microcyst-forming species in detail (Hu et al. 2017); the present study focused on the first identification of S. medusiformis in China. Among the 92 sheep examined, 4 (4.3%) harbored macroscopic cysts of S. medusiformis, marking the first record of this parasite in the country. This prevalence is lower than rates reported in Egypt (5.7%) (El-Morsey et al. 2021), Iran (7.52%) (Farhang-Pajuh et al. 2014), and Italy (12.3%) (Pipia et al. 2016), but higher than that in Australia (3.1%) (Obendorf and Munday 1987). Experimental transmission studies confirm that the domestic cat (Felis catus) is the definitive host for S. medusiformis (Collins 1979; Obendorf and Munday 1987). However, the parasite exhibits relatively low infectivity in cats. Notably, no oocyst or sporocyst shedding was detected in cats fed cystozoites from experimentally infected lambs at 260, 300, and 487 days post-infection (Obendorf and Munday 1987). This reduced infectivity may contribute to the overall low prevalence of S. medusiformis in sheep observed in the current study and in previous reports.
Molecular analysis provides a more sensitive and reliable approach for identifying Sarcocystis species than traditional morphology, particularly given the developmental changes sarcocysts undergo and the existence of morphologically similar cysts in closely related intermediate hosts (Gjerde 2013; Dubey et al. 2016). In this study, we successfully sequenced and submitted 18S rRNA, 28S rRNA, cox1, and ITS-1 sequences of S. medusiformis to GenBank. Notably, the ITS-1 sequences represent the first entry of this genetic marker for the species. BLASTn analysis confirmed up to 100% identity between our sequences and existing S. medusiformis references at the 18S rRNA, 28S rRNA, and cox1 loci, providing robust molecular support for our morphological identification. Phylogenetic analysis consistently placed S. medusiformis within a well-supported clade that includes S. gigantea and S. moulei; however, S. gigantea and S. moulei were more closely related to each other than to S. medusiformis. This phylogenetic pattern reflects the morphological parallels often observed among Sarcocystis species infecting related ruminant hosts. For instance, in sheep, S. tenella, S. arieticanis, and S. gigantea have their morphological counterparts in goats: S. capracanis, S. hircicanis, and S. moulei, respectively (Dubey et al. 2016). Interestingly, while this host-associated pattern is common, sarcocysts morphologically similar to S. medusiformis have not been documented in goats. The sole exception is an unusual finding of similar sarcocysts in an addax (Addax nasomaculatus) in a European zoo (Stolte et al. 1996).
Conclusion
To date, reports on S. medusiformis infections in sheep remain extremely limited, both in case number and geographic distribution. This study provides the first documented evidence of natural S. medusiformis infection in Chinese sheep, significantly expanding the known geographic range of this parasite. Remarkably, sarcocysts morphologically similar to S. medusiformis have been identified only once in a wild bovid species, the addax. The scarcity of available data highlights the need for more extensive sampling of wild and domestic bovid ruminants. Focusing on S. medusiformis and morphologically similar species will enable a deeper understanding of their prevalence, distribution, host specificity, and interspecies relationships within this host group.
A
Author Contribution
DL: Resources, investigation and data collection. LQ, ZH, LX and SD: Resources, investigation and formal analysis. JT and YY: Data curation, review, and editing. JH: Conceptualization, editing, correction, supervision.
A
Funding
This work was supported by the National Natural Science Foundation of China [No. 32260119], the Research Project of Tibet Autonomous Region [No. XZ202301ZY0006N], and the Henan Province modern agricultural industrial technology system [mutton sheep: No. HARS-22-15-G1].
A
Data Availability
All data generated or analyzed during this study are included in this published article. The molecular sequence data are already available in GenBank under accession numbers PV460240, PV460246, PV470857, PV470858, and PV468778, PV468779.
Declarations
Ethics The animal study protocol was approved by the Animal Ethics Committee of Yunnan University (permission number YNU20230466, received date: 3 March 2023).
Conflicts of interest
The authors declare no competing interests.
References
A
Ashford RW (1997) The fox, Vulpes vulpes, as a final host for Sarcocystis of sheep. Ann Trop Med Parasitol 71:29–34. https://doi.org/10.1080/00034983.1977.11687158
A
Barta JR, Martin DS, Liberator PA, Dashkevicz M et al (1997) Phylogenetic relationships among eight Eimeria species infecting domestic fowl inferred using complete small subunit ribosomal DNA sequences. J Parasitol 83(2):262–271
Collins GH, Atkinson E, Charleston WA (1979) Studies on Sarcocystis species III: The macrocystic species of sheep. N Z Vet J 27(10):204–206. https://doi.org/10.1080/00480169.1979.34651
Collins GH (1980) Sarcocystis and the meat industry. Monograph Massey University, New Zealand, pp 1–15
Di Tommaso P, Moretti S, Xenarios I et al (2011) T-Coffee: A web server for the multiple sequence alignment of protein and RNA sequences using structural information and homology extension. Nucleic Acids Res 39:W13–W17. Web Server issuehttps://doi.org/10.1093/nar/gkr245
Dong H, Su R, Wang Y et al (2018) Sarcocystis species in wild and domestic sheep (Ovis ammon and Ovis aries) from China. BMC Vet Res 14(1):377. https://doi.org/10.1186/s12917-018-1712-9
Dubey JP, Speer CA, Munday BL et al (1989) Ovine sporozoan encephalomyelitis linked to Sarcocystis infection. Vet Parasitol 34:159–163. https://doi.org/10.1016/0304-4017(89)90178-7
Dubey JP, Calero-Bernal R, Rosenthal BM et al (2016) Sarcocystosis of animals and humans, 2nd edn. CRC, Boca Raton, FL, USA
El-Morsey A, Abdo W, Zaid AAA et al (2021) Morphologic and molecular identification of three macroscopic Sarcocystis species infecting domestic sheep (Ovis aries) and cattle (Bos taurus) in Egypt. Parasitol Res 120(2):637–654. https://doi.org/10.1007/s00436-020-07002-w
Ezzi A, Gholami MR, Ahourai P (1992) Eosinophilic myositis associated with Sarcocystis in sheep. Arch Inst RAZI 42/43:65–68
Farhang-Pajuh F, Yakhchali M, Mardani K (2014) Molecular determination of abundance of infection with Sarcocystis species in slaughtered sheep of Urmia, Iran. Vet Res Forum 5(3):181–186
Feng Y, Guo R, Sang X et al (2023) A systematic meta-analysis of global Sarcocystis infection in sheep and goats. Pathogens 12(7):902. https://doi.org/10.3390/pathogens12070902
Fenger CK, Granstrom DE, Langemeier JL et al (1995) Identification of opossums (Didelphis virginiana) as the putative definitive host of Sarcocystis neurona. J Parasitol 81(6):916–919
Giannetto S, Poglayen G, Brianti E et al (2005) Sarcocystis gracilis-like sarcocysts in a sheep. Vet Rec 156(10):322–323. https://doi.org/10.1136/vr.156.10.322
Gjerde B (2013) Phylogenetic relationships among Sarcocystis species in cervids, cattle and sheep inferred from the mitochondrial cytochrome c oxidase subunit I gene. Int J Parasitol 43:579–591. https://doi.org/10.1016/j.ijpara.2013.02.004
Gjerde B (2014a) Molecular characterisation of Sarcocystis rileyi from a common eider (Somateria mollissima) in Norway. Parasitol Res 113:3501–3509. https://doi.org/10.1007/s00436-014-4062-y
A
Gjerde B (2014b) Sarcocystis species in red deer revisited: with a re-description of two known species as Sarcocystis elongata n. sp. and Sarcocystis truncata n. Sp. based on mitochondrial cox1 sequences. Parasitology 141: 441–452. https://doi.org/10.1017/S0031182013001819
Gjerde B, de la Fuente C, Alunda JM et al (2020) Molecular characterisation of five Sarcocystis species in domestic sheep (Ovis aries) from Spain. Parasitol Res 119:215–231. https://doi.org/10.1007/s00436-019-06504-6
Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41:95–98
Heydorn AO (1985) The development of Sarcocystis arieticanis n. sp Berl Münch Tierärztl Wochenschr 98(7):231–241
Hu JJ, Huang S, Wen T et al (2017) Sarcocystis spp. in domestic sheep in Kunming City, China: Prevalence, morphology, and molecular characteristics. Parasite 24:30. https://doi.org/10.1051/parasite/2017025
Kang Y, Lu XS, He YH, Wang C et al (2024) First molecular identification and prevalence of Sarcocystis spp. in sheep intended for human consumption in Shanxi province, China. Vet Sci 11(10):504. https://doi.org/10.3390/vetsci11100504
Mehlhorn H, Scholtyseck E (1973) The fine structure of the cyst stages of Sarcocystis tenella. Z Parasitenkd 41(4):291–310
Moulé ML (1886) Sur la psorospermose des bovides. Bull Soc Cent Méd Vét (Parsis) 40 (n. s. 4): 694–696
Mugridge NB, Morrison DA, Jäkel T et al (2000) Effects of sequence alignment and structural domains of ribosomal DNA on phylogeny reconstruction for the protozoan family Sarcocystidae. Mol Biol Evol 17(12):1842–1853. https://doi.org/10.1093/oxfordjournals.molbev.a026285
Nawshirwan S, Heucken N, Piekarek N et al (2023) Morphological, ultrastructural, genetic characteristics and remarkably low prevalence of macroscopic Sarcocystis species isolated from sheep and goats in Kurdistan region, Iraq. Front Vet Sci 10:1225796. https://doi.org/10.3389/fvets.2023.1225796
Obendorf DL, Munday BL (1987) Experimental infection with Sarcocystis medusiformis in sheep. Vet Parasitol 24(1–2):59–65. https://doi.org/10.1016/0304-4017(87)90130-0
O'Donoghue PJ, Ford GE (1986) The prevalence and intensity of Sarcocystis spp. infections in sheep. Aust Vet J 63(9):273–278. https://doi.org/10.1111/j.1751-0813.1986.tb08065.x
Peris MP, Gracia MJ, Moreno B et al (2024) Identification of Sarcocystis spp. in slaughtered sheep from Spain and evaluation of bradyzoite viability after freezing. Vet Sci 11(3):103. https://doi.org/10.3390/vetsci11030103
Pipia AP, Varcasia A, Zidda A et al (2016) Cross-sectional investigation on sheep sarcosporidiosis in Sardinia, Italy. Vet Parasitol Reg Stud Rep 3–4:13–17. https://doi.org/10.1016/j.vprsr.2016.05.004
Railliet A (1886) Psorospermies geanles dans L'oesophage et les muscles du mouton. Bull Acad Vét Fr 40:130–134
Saito M, Shibata Y, Kubo M et al (1997) Sarcocystis mihoensis n. sp. from sheep in Japan. J Vet Med Sci 59(2):103–106. https://doi.org/10.1292/jvms.59.103
Scott PR, Sargison ND (2001) Extensive ascites associated with vegetative endocarditis and Sarcocystis myositis in a shearling ram. Vet Rec 149(8):240–241. https://doi.org/10.1136/vr.149.8.240
Stolte M, Odening K, Bockhardt I (1996) Antelopes (Bovidae) kept in European zoological gardens as intermediate hosts of Sarcocystis species. Parassitologia 38(3):565–570
Sun Y, Ju J, Su X et al (2021) Infection survey and morphological characteristics of Sarcocystis spp. in naturally infected Tibetan sheep from Qinghai in northwestern China. Parasitol Int 80:102219. https://doi.org/10.1016/j.parint.2020.102219
Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular evolutionary genetics analysis version 11. Mol Biol Evol 38(7):3022–3027. https://doi.org/10.1093/molbev/msab120
Wang G, Wei T, Wang X et al (1988) Morphology and life cycle of Sarcocystis microps n. sp. in sheep of Qinghai in China. China Vet Technol 6:9–11 (In Chinese)
Wang G, Wei T, Wang X al (1989) Morphological characterization and life cycle of Sarcocystis cystiformis n. sp. in sheep. Xinjiang Agric Sci 1:37–40 (In Chinese)
Yaziroglu O, Beyazit A (2005) Encephalomyelitis associated with a Sarcocystis-like protozoan in a ten-month-old ewe lamb. Turk J Vet Anim Sci 29:1209–1212
Click here to Correct
Click here to Correct
Table 1. Primers used for the amplification of the four DNA regions
DNA region
Primer name
Primer sequences (5′–3′)
References
18S rRNA
ERIB1a
ACC TGG TTG ATC CTG CCA G
Barta et al.1997
PrimerBb
GATCCTTCTGCAGGTTCACCTAC
Fenger et al. 1995
28S rRNA
KL1a
TACCCGCTGAACTTAAGC
Mugridge et al. 2000
KL3b
CCACCAAGATCTGCACTAG
KL4 a
AGCAGGACGGTGGTCATG-
KL5b
CTCAAGCTCAACAGGGTC
KL6a
GGATTGGCTCTGAGGG
KL2b
ACTTAGAGGCGTTCAGTC
ITS-1
SU1Fa
GATTGAGTGTTCCGGTGAATTATT
Gjerde 2014a
5.8SR2b
AAGGTGCCATTTGCGTTCAGAA
cox1
SF1a
ATGGCGTACAACAATCATAAAGAA
Gjerde 2013
SR9b
ATATCCATACCRCCATTGCCCAT
Gjerde 2013b
aforward primer; breverse primer
Table 2 Similarities of nucleotide sequences between newly sequenced Sarcocystis medusiformis and those previously provided in GenBank
DNA regions
 
Similarity with those previously deposited in GenBank
Sarcocystis sp.
Accession numbers
% Coverage
% Similarity (on average)
18S rRNA
S. medusiformis
MK420021, MT705985
100
99.6–100 (99.8)
S. gigantea
MK420020, OP550293, MT705975, KC209733, L24384
96–100
95.8–96.7 (96.5)
S. moulei
L76473, OP430827, OP430830, OP430832, OP430834, OP430835
96
96.1–96.9 (96.5)
28S rRNA
S. medusiformis
MK420026, MT706454
100
99.6–100 (99.8)
S. gigantea
U85706
100
96.0
S. moulei
AF012884, OP429586, OP430799–OP430803
99–100
95.5–95.7 (95.6)
cox1
S. medusiformis
MK420014, MK420015, MT722971, MT722972
95
99.0–100 (99.5)
S. gigantea
MK420011–MK420013, MT722969, MT722970, KC209601, MK120979
89–95
87.6–88.1 (88.0)
Abstract
This study reports the first detection of Sarcocysits medusiformis in sheep (Ovis aries) in China through integrated morphological and molecular analysis. Macroscopically visible S. medusiformis sarcocysts were found in 4 of 92 examined sheep (4.3%), measuring 2490–4796 × 248–405 μm and exhibiting thin, striated walls (1–2 μm thick). Ultrastructural examination revealed trapezoidal villar protrusions covering the cysts, each lined with an electron-dense layer, with scattered microtubes extending from the apex to the base. Molecular characterization was performed by amplifying and sequencing four genetic markers (18S rRNA, 28S rRNA, ITS-1, and mitochondrial cox1). The newly obtained 18S rRNA, 28S rRNA and cox1 sequences exhibited 100% identify with previously published S. medusiformis sequences in GenBank. Phylogenetic analysis based on these sequences consistently grouped S. medusiformis, S. gigantea, and S. moulei within a distinct clade. To date, S. medusiformis sarcocysts have been documented primarily in sheep, with a single known case in an addax (Addax nasomaculatus). Further investigations involving expanded sampling of wild and domestic bovid ruminants are needed to clarify the epidemiology, host specificity, and phylogenetic relationships of S. medusiformis and morphologically similar species.
Total words in MS: 3182
Total words in Title: 14
Total words in Abstract: 183
Total Keyword count: 5
Total Images in MS: 4
Total Tables in MS: 4
Total Reference count: 39