The miR-142-5p overexpression induces cell cycle arrest and apoptosis by targeting genes MCL1 and CDK6 in pancreatic cancer cells; AsPC-1, PANC-1
Zohreh Haghri 1
Nasrin Motamed 3
Ehsan Arefian 4,5✉ Email
Mahdi Karimi 3
1
A
A
Department of Cellular and Molecular Biology Kish International Campus
2
A
University of Tehran Kish Iran
3
A
Department of Cellular and Molecular Biology, School of Biology, College of Science University of Tehran Tehran Iran
4
A
A
Department of Microbiology, School of Biology, College of Science University of Tehran Tehran Iran
5
A
Department of Microbiology, School of Biology, College of Sciences University of Tehran Tehran Iran
Zohreh Haghri 1 , Nasrin Motamed2, Ehsan Arefian3*, Mahdi Karimi2
1 Department of Cellular and Molecular Biology, Kish International Campus, University of Tehran, Kish, Iran
2 Department of Cellular and Molecular Biology, School of Biology, College of Science, University of Tehran, Tehran, Iran
3 Department of Microbiology, School of Biology, College of Science, University of Tehran, Tehran, Iran
Corresponding Author: Ehsan Arefian
Department of Microbiology, School of Biology, College of Sciences, University of Tehran, Tehran, Iran
Email: Arefian@ut.ac.ir
https://orcid.org/0000-0002-0758-4710
Abstract
Pancreatic ductal adenocarcinoma (PDAC) is among the most lethal cancers worldwide, and there is an urgent demand for novel therapeutic approaches. MicroRNAs (miRNAs) are promising molecules to regulate gene expression in PDAC. This study investigates the role of miR-142 in cell proliferation and apoptosis in two cell lines, AsPC-1 and PANC-1, with a focus on gene expression changes of selected genes induced by overexpression of miR-142-5p. The molecular features in PDAC were evaluated using KEGG, and significant genes in cell cycle regulation, apoptosis, and PI3k/AKT pathway were selected (CDK6, MCL1, PIK3CA). DIANA-microT-CDS and TargetScan version 7.1 were used to select miR-142 based on prediction score. Selected genes did not contain any predicted seed site matches for the 3p arm of miR-142. miR-142 was overexpressed by transfecting a vector carrying the pre-miRNA-142 sequence into two pancreatic cancer cell lines. Overexpression of miR-142 and its effect on downregulating target genes was confirmed by quantitative real-time PCR (RT-qPCR). Predicted target genes (CDK6 and MCL1) were evaluated by the Luciferase assay. Apoptosis and cell cycle arrest were performed to analyze cell proliferation and cell viability under the effect of miR-142. Our results showed that miR-142-5p reduced the expression of its target genes. Cell cycle arrest was increased in both cell lines, while apoptosis increased in PANC-1. Overall, miR-142 may function as a tumor suppressor in PDAC by downregulating the overexpressed cancer-related genes and suppressing proliferation in AsPC-1 and PANC1.
Key words:
Pancreatic ductal adenocarcinoma
gene therapy
MCL1
CDK6
cell cycle arrest
Apoptosis
Introduction
Pancreatic cancer (PC) ranks among the most lethal human malignancies, with a 5-year survival rate of only 13% and a median survival of approximately 4 months, primarily due to late diagnosis and limited therapeutic achievements (1). PC is currently the sixth leading cause of death among cancers worldwide (2), however, by 2030, it may overtake breast cancer and become the second most common cause (1, 3).
Approximately 90% of PC cases are classified as pancreatic ductal adenocarcinoma (PDAC), an exocrine tumor originating from noninvasive precursor lesions known as pancreatic intraepithelial neoplasia (PanIN) in which genetic alterations begin (KRAS, CDKN2, TP53) (4, 5).
The poor prognosis associated with PDAC is attributed mainly to the lack of reliable early detection methods, as PC typically remains non-symptomatic at its early stages. Consequently, 80% of patients are diagnosed at advanced stages, with metastasis to regional lymph nodes and the liver often occurring (6, 7). However, surgical resection remains the most effective and curative treatment; its success is limited to cases detected early (10–15%) (8). Modified FOLFIRINOX (mFOLFIRINOX), a combination of 5-fluorouracil (5-FU), leucovorin, oxaliplatin, and irinotecan and nab-paclitaxel in combination with gemcitabine, is regarded as the most effective adjuvant therapy, although it exhibits considerable toxicity and modest survival rate changes. Due to the inter- and intratumor heterogeneity of pancreatic tumors, therapeutic resistance has faced a challenge that extends to chemotherapy and radiotherapy (7). Therefore, identifying gene-targeted therapy strategies has become increasingly important, particularly through the modulation of key molecular drivers. The 2021 FDA approval of Sotorasib, a KRAS^G12C inhibitor for non-small-cell lung cancers (NSCLCs), is a landmark example of targeted therapy (9). Gene therapy, which emerged in the early 1990s, is a novel and potentially curative approach for various inherited or acquired illnesses, including cancer, by directly targeting specific molecules involved in carcinogenesis while minimizing side effects (10, 11). This therapeutic policy involves the delivery of exogenous nucleic acids (such as genes, gene fragments, miRNAs, siRNAs) into cells to modify a target gene, regulate its expression, and alter mRNA levels, or produce an exogenous protein (12). Genetic alterations, such as the dysregulated expression of microRNAs or miRNAs, play a major role in cancer development and progression, and their expression can potentially be restored through gene therapy (12, 13).
miRNAs are small non-coding RNA molecules (~ 22 nucleotides) that post-transcriptionally regulate gene expression by inhibiting translation or mRNA degradation, without altering the gene sequence (14, 15). They play a key role in regulating cellular processes, including proliferation, differentiation, cell survival and apoptosis, DNA repair, and Angiogenesis (12, 13, 15). Extensive research has shown miRNAs are dysregulated in various cancers, including pancreatic cancer, presenting their essential role in tumor development (14, 15). miR-142, located on human chromosome 17q22, give rise to two mature strands: 5p and 3p (16). miR-142 is recognized as a tumor suppressor miRNA, showing decreased expression in pancreatic cancer (14, 17, 18). Beyond cancer, miR-142 is involved in inflammation, virus infections, and immune tolerance (19).
The downregulation of miRNA in cancer results in the overexpression of target genes that promote tumor progression through enhanced cell growth, proliferation, and differentiation (10, 14, 17, 19). Although its biological function has not been recognized yet, previous studies showed that miR-142-5p is downregulated in pancreatic cancer tumor tissues and PanC1, BxPC3, SW1990, and CAPAN-1 cell lines (14, 20). Furthermore, miR-142-5p suppresses pancreatic cancer growth and enhances antitumor immunity by regulating PD-L1 (21).
In this study, we selected potential key target genes involved in carcinogenesis and progression pathways, including MCL1 (an anti-apoptotic protein) (22), CDK6 (a cell cycle promoter) (23), and PIK3CA (a regulator of PI3K/AKT signaling) (24). Based on bioinformatics analyses, miR-142-5p was identified as a key regulator of these genes. To experimentally evaluate the impact of miR-142-5p on the selected genes, we overexpressed pre-miR-142 in two PDAC cell lines (AsPC-1 and PANC-1). Gene expression changes were investigated using RT-qPCR, and cell behavior was analyzed through flow cytometry to assess cell cycle progression and apoptosis. Finally, a dual-luciferase reporter assay was performed for CDK6 and MCL1 to confirm the direct targeting of these oncogenes by miR-142.
This study suggests that miR-142-5p functions as a significant tumor-suppressing miRNA with potential applications in gene therapy to counteract oncogenic activity in pancreatic cancer.
Methods and materials
In Silico
Initially, pancreatic cancer was analyzed in terms of its molecular features and pathways using the Kyoto Encyclopedia of Genes and Genomes website (KEGG) (https://www.genome.jp/kegg/pathway.html) ( https://www.genome.jp/kegg/disease/) (25). Selected genes were validated for overexpression in pancreatic cancer cohorts, comparing pancreatic cancer cells to normal cells through GEPIA2 (http://gepia2.cancer-pku.cn/) (26) This analysis aimed to identify critical overexpressed genes, focusing on hallmark cancer pathways such as cell cycle regulation, cell survival, and PI3K/AKT signaling pathway mechanisms (7) miR-142-5p was identified through TargetScan 7.2 (http://www.targetscan.org/vert_71/) using the Context + + score (CS) percentile and DIANA-microT-CDS http://diana.imis.athena-innovation.gr/ and miRbase database (2729). Only genes with predicted canonical seed binding sites for miR-142-5p in their 3′ untranslated regions (3′UTRs) were included. No canonical target sites were identified for the miR-142-3p strand. Additionally, the downregulation of miR-142-5p in tumors versus normal tissue was further analyzed by the OncomiR database (https://oncomir.org ) (30). Key features of the two cell lines, AsPC-1 (ATCC® CRL-1682™) and PANC-1 (ATCC® CRL-1469™), were obtained from the ATCC database (31, 32).
Cloning of miRNA gene
A
miR-142 (MI0000460) was assessed from the miRbase database http://www.mirbase.org/, and miR-142-5p (MIMAT0000433 ) was selected for further investigation (29). The amplicon was amplified by the polymerase chain reaction (PCR) technique on the genomic DNA template of pre-miR-142 inserted into the cloning site of the pCDH-GFP-Puro lentiviral vector (System Biosciences, USA; Cat. No.CD510B-1). EcoRI and BamHI (Thermo Fisher Scientific, USA,) were selected as restriction enzymes. Finally, the cloning vector was transformed into the Escherichia coli (E. coli) competent cells and the pre-miRNA sequence was aligned by MEGA software to confirm its structure (33).
Cell Lines and Culture Conditions
The cell lines, PANC-1, AsPC-1, and human embryonic kidney cells (HEK293T) were purchased from the Iranian Biological Resource Center (IBRC, Iran). All Cell lines were cultured according to standard protocols. AsPC-1 cells were maintained in RPMI-1640 medium (BIO-IDEA, Iran), while PANC-1 and HEK cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) containing glucose (BIO-IDEA, Iran). Both media were supplemented with 10% fetal bovine serum (FBS) (Gibco,USA), 2 mM L-glutamine (Sigma-Aldrich, USA), 1 mM sodium pyruvate (Sigma-Aldrich, USA), and 1% penicillin-streptomycin (100 U/mL penicillin, 100 µg/mL streptomycin; Sigma-Aldrich, USA). Cell cultures were incubated at 37°C in a humidified atmosphere of 95% humidity and 5% CO₂.
Cell Transfection
The cloned miR-142 in pCDH-GFP-Puro lentiviral vector (System Biosciences, USA, Cat. No. CD510B-1) was transfected into AsPC-1 and PANC-1 using Lipofectamine® 2000 (Invitrogen, USA, Cat. No.11668019) following the manufacturer’s protocol. For the scramble group, an empty pCDH vector was transfected into both cell lines. A day before transfection, cells were seeded in 6-well sterile culture plates at a density of 2×10⁵ cells/well with 70% to 90% confluency without antibiotics. Cells were incubated at 37°C in a CO2 incubator. After 24 hours of transfection, 50% of the medium was replaced with fresh complete medium with 5% FBS and 1% penicillin-streptomycin. The transfection efficiency was assessed after 48 hours using a fluorescent microscope to visualize GFP expression in cells.
Gene Expression Analyses
Total RNA was extracted for synthesizing complementary DNAs (cDNA) 48 hours after transfection using TRIzol reagent (RNX-Plus), based on the manufacturer’s protocol (Sinaclon, Cat No EX6101). RNA concentration was determined using a Nano Drop spectrophotometer. For cDNA synthesis, 5 µg of Total RNA was used for target genes and 1µg for miR-142-5p. Reverse transcription was performed using MMLV reverse transcriptase enzyme, Random hexamers were used for target genes, and stem-loop RT primers were used for miR-142-5p and Snord47, based on the manufacturer’s protocol (Parstous, Iran Cat: a101161). RT-qPCR was performed with YTA SYBR GREEN qPCR Master Mix 2x (Yektajhiz, Iran, Cat No: YT2551) following the manufacturer’s protocol. Expression levels were measured based on the 2-ΔΔCt method. Snord47 was used as an endogenous control for miR-142-5p, and β2M (Beta-2-microglobulin) was used for target genes. Each reaction was amplified twice. primers were designed using the Primer-Blast tool and are listed in Table 1.
Table 1
Primer sequences of the target genes, β2m, miR-424–5p and SNORD47 for Real-Time PCR evaluation
Primers
Forward
Reverse
 
CDK6
GCGACTTGAAGAACGGA
ATCAAACAACCTGACCAC
 
PIK3CA
AGAGCCCCGAGCGTTTCTG
AGAGCCCCGAGCGTTTCTG
 
MCL1
AACAAAGAGGCTGGGATG
ATTGCACTTACAGTAAGGCTATC
 
β2m
ATGCCTGCCGTGTGAAC
ATCTTCAAACCTCCATGATG
 
Primers
Forward
RT
 
miR-142-5p
GGAGCATAAAGTAGAAAG
GTCGTATGCAGTGCAGGGTCCGAGGTATTCGCACTGCATACGACAGTAGT
 
SNORD47
ATCACTGTAAAACCGTTCCA
GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACAACCTC
 
Universal Reverse Primer
 
GAGCAGGGTCCGAGGT
 
Apoptosis assay
Cells were seeded in 12-well sterile culture plates, and transfection was done by Lipofectamine® 2000 according to the manufacturer’s instructions. The scrambled group was an empty pCDH vector, and the treatment group was pCDH carrying miR142. After 48 hours, cells were collected by trypsin/EDTA (BIO-IDEA, IRAN), washed twice with 1mL PBS in 1.5 mL microtubes, and centrifuged at approximately 1500× g for 5 minutes at room temperature (24°C). Cell pellets were resuspended in 1x binding buffer and stained with Annexin V-PE (PE) (BD Biosciences, USA) and 7-aminoactinomycin D (7-AAD). It was rinsed with PE and left for 15 minutes at room temperature in the dark. Then, after washing, 7AAD was added, and apoptosis was quantified using a BD FACS Calibur (BD biosciences, San Jose, CA, USA), and data were analyzed by FlowJo v10 software (FlowJo LLC, USA). Experiments were performed in biological triplicates.
Cell cycle assay
AsPC-1 and PANC-1 cells were plated in 12-well sterile culture plates and transfected with Lipofectamine® 2000. After harvesting with Trypsin/EDTA and washing with PBS, cells were fixed by adding cold ethanol 70% dropwise on the vortex and kept overnight at -20°C. Fixed cells were centrifuged and washed with PBS. Then, 1ml PI MASTER MIX, containing 1 mg/ml Propidium iodide (PI), 10MG/ML RNase (DNaseFREE) was added. The result was quantified after 30 minutes incubation at 37°C by flow cytometry BD FACS Calibur (BD biosciences, San Jose, CA, USA) and data were assessed by FlowJo v10 software (FlowJo LLC, USA)
Luciferase assay
The 3' untranslated region (3'-UTR) of CDK6 and MCL1 was previously cloned into the Dual-luciferase reporter psiCHECK 2.0 vectors (Promega, Wisconsin) downstream of the Renilla luciferase coding region. HEK293T Cells were seeded in 48-well plates at a density of 1 × 10⁴ cells per well 24 hours before transfection to reach 70–80% confluency. The day after, cells were co-transfected with psiCHECK/3'-UTR constructs and PCDH/miR-142 using PEI MAX (PolyScience, USA) based on the manufacturer’s protocol. psiCHECK/3’-UTR of the genes was used as a negative control. Luciferase was measured 48 hours post-transfection with the Dual-Luciferase Reporter Assay System (Promega, USA). Renilla luciferase activity normalized to Firefly luciferase activity.
Statistical analysis
GraphPad Prism software (version 10.4.1; GraphPad Software, San Diego, CA, USA) was used for statistical analyses. (GraphPad Software 2023). All data are presented as mean ± standard deviation. A p-value of < 0.05 was noticed as a statistically significant difference. We applied Student’s t-test for comparing between two groups (treated, scramble control) for real-time PCR and Apoptosis assay, and two-way ANOVA was used for evaluating differences in cell cycle assay and Luciferase assay.
Result
In Silico analysis
miRbase revealed the considerable difference in the expression level of two strands of miR-142, which indicates that the 5p strand is the dominant strand with a higher expression level in humans (29). Bioinformatic analysis using TargetScan 7.2 and DIANA-microT-CDS, was predicted the binding site of miR-142-5p to the 3ʹUTR regions of MCL1, CDK6 and PIK3CA. Notably, there were no predicted binding sites for miR-142-3p. (Table 2).
Table 2
Context + + Score for matching miR-142-5p and intended genes by Target Scan 7.2 and miTG score from DIANA MicroT-CDS
 
The predicted consequential pairing of the target region (top) and miRNA (bottom)
Site type
Context + + score
MiTGscore
Position 1675–1682 of PIK3CA 3' UTR hsa-miR-142-5p
5'   ...UAUUAUUGGAAAACAACUUUAUA...
8mer
-0.03
0.857273794
|||||||
3'        UCAUCACGAAAGAUGAAAUAC
Position 1627–1633 of CDK6
3' UTR hsa-miR-142-5p
5'   ...GUUUUCUCUACAGUCCUUUAUAU...
7mer-A1
-0.02
0.918946478
||||||
3'       UCAUCACGAAAGAUGAAAUAC
Position 2228–2234 of MCL1
3' UTR hsa-miR-142-5p
5'   ...GUUUCCAUGAUUCUUACUUUAUU...
7mer- m8
-0.02
0.858344846
|||||||
3'        UCAUCACGAAAGAUGAAAUAC
C D
In parallel, using GEPIA2 (Gene Expression Profile Interactive Analysis) revealed that the expression of these genes was notably increased in 179 pancreatic adenocarcinoma samples compared to 171 normal pancreatic tissue, based on TCGA and GTEX data (P < 0.01, Fig. 1). The expression profile of miR-142-5p was analyzed via OncomiR database analysis, which shows the expression level significantly downregulated in pancreatic adenocarcinoma (PAAD) compared to normal pancreatic tissue (Log2 fold change ≈ -2.77, p = 0.0495). The mean Log2 expression in tumor samples was 4.80 versus 7.57 in normal tissues, indicating a -6.9 fold change reduction (Fig. 2).
Fig. 1
GEPIA2 result shows the overexpression of PIK3CA, CDK6, and MCL1 through boxplot in PAAD. Data reached from 179 pancreatic adenocarcinoma samples (Red box) compared to 171 normal pancreatic tissue (Grey box), based on TCGA and GTEX data (P < 0.01)
Click here to Correct
Fig. 2
The OncomiR database shows Tumorigenesis is significantly associated with down regulation of miR-142-5p in PAAD. The expression level of miR-142-5p is significantly lower in the tumor sample compared to normal, which shows approximately a -6.9 fold change reduction.
A) B)
Click here to Correct
Click here to Correct
miR-142-5p Downregulate MCL1, CDK6 and PIK3CA
To evaluate the biological assays, after transfection of pre-miR-142 into AsPC-1 and PANC-1 cell lines using Lipofectamine 2000, the expression of miR-142-5p was confirmed by RT-qPCR. The fold change of miR-142-5p expression was (8.72 ± 1.777) in PANC-1 and (5.98 ± 0.311) in AsPC-1, compared to the scramble control. (P**< 0.01 and p**** < 0.0001 Fig. 3. A, B) To assess the impact of miR-142-5p on target genes, qRT-PCR was conducted 48 hours after transfection. The result shows a significant decrease in the mRNA levels of MCL1, CDK6, and PIK3CA in both cell lines compared to the scramble group. Results are normalized with β2m and fold changes are: 0.064 ± 0.0105 (p**** < 0.0001) and 0.231 ± 0.1559 (p** < 0.01) for MCL1, CDK6 0.238 ± 0.1094 (p*** < 0.001) and 0.001 ± 0.0005 (p**** < 0.000)1, PIK3CA 0.070 ± 0.0065 (p**** < 0.0001) and 0.002 ± 0.0015 )p**** < 0.0001) respectively in PANC-1 and AsPC-1 (Fig. 3C,D).
Fig. 3
RT-qPCR analysis of miR-142-5p expression and its effect on target genes (A, B). miR-142-5p was notably overexpressed in AsPC-1 (FC = 5.98 ± 0.31) and PANC-1 cells (FC = 8.72 ± 1.77). (C) Overexpression of miR-142-5p in AsPC-1 significantly decreased the mRNA level of genes including CDK6 (FC = 0.0017 ± 0.00057 ), MCL1 (FC = 0.231 ± 0.155) and PIK3CA (FC = 0.002 ± 0.0015). (D) Similarly, in PANC-1, CDK6 (FC = 0.238 ± 0.1094) MCL1 (FC = 0.070 ± 0.0065) and PIK3CA (FC = 0.064 ± 0.010) expression level was decreased. Data are shown as mean ± SD biological repeats (** p*<0.05) (** p < 0.01) (*** p < 0.001) and (**** p < 0.0001) by unpaired t-test.
A) PANC-1 Scramble PANC-1 Treatment
Click here to Correct
miR-142 is a Tumor suppressor
To validate the tumor suppressor effect of miR-142, cell cycle assay and apoptosis assay were performed by flow cytometry. We performed an apoptosis assay with Annexin V-PE/7AAD, and the result demonstrated that the early and late apoptosis were enhanced in PANC-1 (9% ± 0.63) compared to scramble (4% ± 2.3). In contrast, apoptosis level did not change significantly in the treatment group of AsPC-1 compared to the scramble group (Fig. 4). To explore whether miR-142 would interfere with cell proliferation, a cell cycle assay was performed. In PANC-1, the percentage of cells at the G0/G1 phase in the scramble group was 50.68 ± 0.51, and in the miR-142 treated group, was reached 56.43% ± 1.40. Similarly, in AsPC-1 cells, in the scramble group, the percentage of G0/G1 was 45.34% ± 0.67, while in the treated group rose to 63.55% ± 7.76. Therefore, the Results indicated that miR-142 overexpression arrests the cell cycle in the G1 phase in both cell lines. **p < 0.01; ***p < 0.001 (Fig. 4, 5)
Fig. 4
Apoptosis mediated by miR-142 in AsPC-1 and PANC-1. (A, B) Apoptosis increased significantly in PANC-1 after transfection of miR-142. Treatment group (FC = 9%±0.63), scramble group (FC = 4% ± 2.3) (C, D); However, in AsPC-1, the percentage of apoptotic cells in the treatment was not statistically changed. Data are shown as mean ± SD biological repeats (*p < 0.05) (**p < 0.01) (*** p < 0.001) by two-way Anova by statistical analyses. SD = standard deviation. C) AsPC-1 Scramble AsPC-1 Treatment
A) B) Scramble Treatment
Click here to Correct
Fig. 5
Cell cycle arrest in PANC-1 and AsPC-1 cells following miR-142 overexpression. (A, B) In PANC-1, Flow cytometry analysis shows that cells at the G2 phase decreased in treatment compared to the control group; therefore, cells are arrested predominantly at the G1 phase of the cell cycle. (C, D) Similarly, in AsPC-1 cells, arrest occurred in G1 phase, and cells decreased in S phase compared to the control group. Data are shown as mean ± SD (*p < 0.05) (**p < 0.01) (***p < 0.001) by two-way Anova by statistical analyses. SD = standard deviation. C) D) Scramble Treatment
Click here to Correct
miR-142 Targets 3'-UTR of CDK6 and MCL1 precisely
To validate whether the direct target of CDK6 and MCL1 is miR-142, HEK293 cells were co-transfected with a miR-142/PCDH vector and psiCHECK/CDK6 and psiCHECK/MCL1 separately. The scramble groups were transfected with psiCHECK/CDK6 and psiCHECK/MCL1. (****p < 0.0001) (*P < 0.05) (Fig. 6).
Fig. 6
The dual-luciferase reporter assay shows miR-142 targets CDK6 and MCL1 precisely. The genes were cloned downstream of the luciferase gene in the psiCHECK vector, and by transfecting miR-142, the light intensity of the luciferase enzyme fell in the vector with 3'UTR of CDK6 from 6.205 ± 0.935 to 0.815 ± 0.015 (****p < 0.0001) and 3'UTR of MCL1 from 1.897 ± 0.2178 to 0.768 ± 0.048 (*p < 0.05). Data are shown as ± SD in three different investigations.
Click here to Correct
Discussion
PDAC is a principal cause of death among malignancies, distinguished by its asymptomatic behavior in early stages, and despite extensive studies, effective therapies remain limited. Gene therapy, including miRNAs, may provide a new approach with encouraging outcomes for combating malignancy. miRNAs regulate gene expression post-transcriptionally and before protein synthesis. Altered miRNA expression is recognized as a pivotal molecule in cancer development and progression (34). Notably, miRNAs can significantly modulate oncogenes and overexpressed genes as a tumor suppressor (35). Thus, targeting or modulating miRNAs represents a novel therapeutic strategy in cancer gene therapy. Cellular processes, including apoptosis and cell cycle regulation, along with the PI3K signaling pathway, could have a significant effect on cancer initiation and progression of PDAC (22, 24). Consequently, we aimed to investigate the regulatory effect of miR-142-5p on three important genes in PDAC, MCL1, CDK6, and PIK3CA. MCL1, an antiapoptotic member of the BCL2 family, is frequently overexpressed in PDAC and allows cancer cells to evade apoptosis and survive under stress conditions (hypoxia and chemotherapy), which leads to tumorigenesis and resistance to chemotherapeutic drugs. (22, 36, 37). CDK6 is a key regulatory enzyme that facilitates the transition from G1 to S phase of the cell cycle by phosphorylating the Retinoblastoma (RB) protein, thereby promoting cell proliferation(23). Overexpression of CDK6 has been reported in many malignancies, such as PDAC (38). PIK3CA encodes p110 protein, the catalytic subunit of PI3K, which contributes to the regulation of cell growth, survival, and metabolism. Alterations in PIK3CA hyperactivate the PI3K/AKT/mTOR pathway, promoting tumor growth and therapeutic resistance in PDAC. Therefore, regulating these genes through gene therapy could represent an important approach in pancreatic cancer treatment. Cao et al. demonstrated that CDK6 assists in migration and invasion in pancreatic cancer cell lines AsPC-1 and SW1990, and overexpression of CDK6 suppresses the tumor suppressor miR-3613-5p, thereby enhancing the metastatic potential (39). Lu et al reported that miR-142 is downregulated in pancreatic cancer tissue and PANC-1, SW1990, Hup, and CFPAC-1 cell lines, compared to the control group. They revealed that miR-142 targets HIF-1α and its overexpression inhibits invasion and proliferation in PANC-1 and SW1990 (19). Consistent with our study, Zhu et al and Yoa et al showed in separate studies that miR-142-5p is downregulated in PDAC. Zhu et al analyzed 35 paired pancreatic cancer tissue samples, adjacent normal tissues, as well as four pancreatic cancer cell lines, and validated the tumor suppressor effect of miR-142-5p. They showed that miR-142-5p inhibits cell proliferation in PANC-1 by targeting PIK3CA (14, 20). Likewise, the overexpression of miR-142-5p inhibits cell proliferation and induces apoptosis in PANC-1 cells via targeting RAP1A(20). Neither of the previous studies, however, investigated the effect of miR-142 strands on proliferation through cell cycle assay (14, 19, 20). In contrast, our study not only demonstrated that miR-142 induces apoptosis in PANC-1 cells but also uniquely indicated that miR-142 causes G1-phase cell cycle arrest in both cell lines by targeting MCL1, CDK6, and PIK3CA. Specifically, in AsPC-1 cells, the G0/G1 phase increased from 45.34% ± 0.67 in the control group to 63.55% ± 7.76 in the treated group, and in PANC-1 cells, it increased from 50.68% ± 0.51 to 56.43%, which leads to suppression in proliferation in both cell lines. In our study, GEPIA2 revealed the aberrant expression of MCL1, CDK6, and PIK3CA in pancreatic adenocarcinoma (PAAD), and we confirmed the downregulation of target genes MCL1, CDK6, and PIK3CA by RT-qPCR following miR-142-5p overexpression (26). Additionally, a Dual-luciferase reporter assay suggested that miR-142 reduced the luciferase activity of MCL-1 and CDK6 significantly. Although luciferase validation was not performed for PIK3CA, its regulation was strongly supported by bioinformatic tools and RT-qPCR.
Integrated target prediction tools, Target Scan and microT-CDS, identified potential target genes MCL1, CDK6, and PIK3CA by each containing seed matches for miR-142-5p in their 3′UTRs (27, 29). Consistently, the expression profile in miR-base shows that miR-142-5p is the predominant strand in humans. Therefore, these findings suggest that the effects of apoptosis, cell cycle assay, and luciferase assay on two cell lines are likely mediated by miR-142-5p. Based on the OncomiR database analysis, miR-142-5p expression was significantly reduced in PAAD tissues in comparison with normal pancreatic tissues (30). The mean log2 expression levels were 4.80 in tumor samples and 7.57 in normal samples, indicating an approximately 6.9-fold decrease.
Although our results are promising, apoptosis was not observed in AsPC-1 cells, while it was manifested in PANC-1 cells. This discrepancy could be attributed to the fundamental distinctions between the two cell lines, since they originate from different sources and exhibit various dependencies on anti-apoptotic proteins such as MCL-1. AsPC-1 is derived from the ascitic fluid of a patient with metastatic pancreatic adenocarcinoma, while PANC-1 is established from a primary pancreatic ductal adenocarcinoma (40, 41). Although both exhibit invasive behavior, AsPC-1 has been reported to demonstrate more aggressiveness and metastatic potential compared to PANC-1(42, 43).
A
According to Takahashi et al, MCL-1 protein is not detectable in the AsPC-1 cell line, and the survival of this cell line mainly depends on Bcl-xl as an anti-apoptotic factor. Therefore, targeting MCL-1 alone could not be sufficient to induce apoptosis in AsPC-1. In contrast, in PANC-1, MCL-1 is detectable by western blot, and although targeting of MCL-1 alone may not always lead to apoptosis in PANC-1 (44). Our study suggests that by targeting oncogenic pathways simultaneously, including cell survival, cell regulation through specific genes, and apoptosis is evident.
In conclusion, our research suggests that miR-142 acts as a multitarget inhibitor in pancreatic cancer by targeting key regulators of cell proliferation and apoptosis as a therapeutic candidate. More investigations are demanded to confirm the safety and therapeutic potential of miR-142-5p. Potential delivery systems should also be investigated in combination with current chemotherapeutic agents.
A
Acknowledgement
The authors appreciate the valuable advice and technical support provided by the laboratory staff.
Reference
1.
Stoop TF, Javed AA, Oba A, Koerkamp BG, Seufferlein T, Wilmink JW, et al. Pancreatic cancer. Lancet. 2025;405(10485):1182–202.
2.
Leiphrakpam PD, Chowdhury S, Zhang M, Bajaj V, Dhir M, Are C. Trends in the global incidence of pancreatic cancer and a brief review of its histologic and molecular subtypes. J Gastrointest Cancer. 2025;56(1):71.
3.
Rahib L, Smith BD, Aizenberg R, Rosenzweig AB, Fleshman JM, Matrisian LM. Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States. Cancer Res. 2014;74(11):2913–21.
4.
Wood LD, Canto MI, Jaffee EM, Simeone DM. Pancreatic cancer: pathogenesis, screening, diagnosis, and treatment. Gastroenterology. 2022;163(2):386–402. e1.
5.
Hu J-X, Zhao C-F, Chen W-B, Liu Q-C, Li Q-W, Lin Y-Y, et al. Pancreatic cancer: A review of epidemiology, trend, and risk factors. World J Gastroenterol. 2021;27(27):4298.
6.
Mizrahi JD, Surana R, Valle JW, Shroff RT. Pancreatic cancer. Lancet. 2020;395(10242):2008–20.
7.
Wang S, Zheng Y, Yang F, Zhu L, Zhu X-Q, Wang Z-F, et al. The molecular biology of pancreatic adenocarcinoma: translational challenges and clinical perspectives. Signal Transduct Target therapy. 2021;6(1):249.
8.
Park W, Chawla A, O’Reilly EM. Pancreatic cancer: a review. JAMA. 2021;326(9):851–62.
9.
Hong DS, Fakih MG, Strickler JH, Desai J, Durm GA, Shapiro GI, et al. KRASG12C inhibition with sotorasib in advanced solid tumors. N Engl J Med. 2020;383(13):1207–17.
10.
Roma-Rodrigues C, Rivas-García L, Baptista PV, Fernandes AR. Gene therapy in cancer treatment: why go nano? Pharmaceutics. 2020;12(3):233.
11.
Abas MDM, Asri MFM, Yusafawi NAS, Rosman NAZ, Baharudin NAZ, Taher M, et al. Advancements of gene therapy in cancer treatment: a comprehensive review. Pathology-Research Pract. 2024;261:155509.
12.
Abou Madawi NA, Darwish ZE, Omar EM. Targeted gene therapy for cancer: the impact of microRNA multipotentiality. Med Oncol. 2024;41(9):214.
13.
Menon A, Abd-Aziz N, Khalid K, Poh CL, Naidu R. miRNA: a promising therapeutic target in cancer. Int J Mol Sci. 2022;23(19):11502.
14.
Zhu J, Zhou L, Wei B, Qian Z, Wang J, Hui H, et al. miR-142-5p inhibits pancreatic cancer cell migration and invasion by targeting PIK3CA. Mol Med Rep. 2020;22(3):2085–92.
15.
Sun LL, Li WD, Lei FR, Li XQ. The regulatory role of micro RNA s in angiogenesis-related diseases. J Cell Mol Med. 2018;22(10):4568–87.
16.
Zhang B, Zhao D, Chen F, Frankhouser D, Wang H, Pathak KV, et al. Acquired miR-142 deficit in leukemic stem cells suffices to drive chronic myeloid leukemia into blast crisis. Nat Commun. 2023;14(1):5325.
17.
Daoud AZ, Mulholland EJ, Cole G, McCarthy HO. MicroRNAs in Pancreatic Cancer: biomarkers, prognostic, and therapeutic modulators. BMC Cancer. 2019;19(1):1130.
18.
Fathi M, Ghafouri-Fard S, Abak A, Taheri M. Emerging roles of miRNAs in the development of pancreatic cancer. Biomed Pharmacother. 2021;141:111914.
19.
Lu Y, Ji N, Wei W, Sun W, Gong X, Wang X. MiR-142 modulates human pancreatic cancer proliferation and invasion by targeting hypoxia-inducible factor 1 (HIF-1α) in the tumor microenvironments. Biology open. 2017;6(2):252–9.
20.
Yao R, Xu L, Wei B, Qian Z, Wang J, Hui H, et al. miR-142-5p regulates pancreatic cancer cell proliferation and apoptosis by regulation of RAP1A. Pathology-Research Pract. 2019;215(6):152416.
21.
Jia L, Xi Q, Wang H, Zhang Z, Liu H, Cheng Y, et al. miR-142-5p regulates tumor cell PD-L1 expression and enhances anti-tumor immunity. Biochem Biophys Res Commun. 2017;488(2):425–31.
22.
Wang H, Guo M, Wei H, Chen Y, Targeting. MCL-1 in cancer: current status and perspectives. J Hematol Oncol. 2021;14(1):67.
23.
Goel S, Bergholz JS, Zhao JJ. Targeting CDK4 and CDK6 in cancer. Nat Rev Cancer. 2022;22(6):356–72.
24.
Wang Y, Rozen V, Zhao Y, Wang Z. Oncogenic activation of PIK3CA in cancers: Emerging targeted therapies in precision oncology. Genes Dis. 2025;12(2):101430.
25.
Kanehisa M, Goto S. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000;28(1):27–30.
26.
Tang Z, Kang B, Li C, Chen T, Zhang Z. GEPIA2: an enhanced web server for large-scale expression profiling and interactive analysis. Nucleic Acids Res. 2019;47(W1):W556–60.
27.
Agarwal V, Bell GW, Nam J-W, Bartel DP. Predicting effective microRNA target sites in mammalian mRNAs. elife. 2015;4:e05005.
28.
Vlachos IS, Paraskevopoulou MD, Karagkouni D, Georgakilas G, Vergoulis T, Kanellos I, et al. DIANA-TarBase v7. 0: indexing more than half a million experimentally supported miRNA: mRNA interactions. Nucleic Acids Res. 2015;43(D1):D153–9.
29.
Kozomara A, Birgaoanu M, Griffiths-Jones S. miRBase: from microRNA sequences to function. Nucleic Acids Res. 2019;47(D1):D155–62.
30.
Wong NW, Chen Y, Chen S, Wang X. OncomiR: an online resource for exploring pan-cancer microRNA dysregulation. Bioinformatics. 2018;34(4):713–5.
31.
(ATCC) ATCC. AsPC-1 [Human pancreatic adenocarcinoma] (ATCC® CRL-1682™).
32.
(ATCC) ATCC. PANC-1 [Human pancreatic epithelioid carcinoma] (ATCC® CRL-1469™).
33.
Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35(6):1547–9.
34.
Chakrabortty A, Patton DJ, Smith BF, Agarwal P. miRNAs: potential as biomarkers and therapeutic targets for cancer. Genes. 2023;14(7):1375.
35.
Rupaimoole R, Slack FJ. MicroRNA therapeutics: towards a new era for the management of cancer and other diseases. Nat Rev Drug Discovery. 2017;16(3):203–22.
36.
Cui J, Placzek WJ. Post-transcriptional regulation of anti-apoptotic BCL2 family members. Int J Mol Sci. 2018;19(1):308.
37.
Chen X, Zeh HJ, Kang R, Kroemer G, Tang D. Cell death in pancreatic cancer: from pathogenesis to therapy. Nat reviews Gastroenterol Hepatol. 2021;18(11):804–23.
38.
Zhao YX, Xu BW, Wang FQ, Jiang FY, Xu JW, Yu DX. nc-RNA‐mediated high expression of CDK6 correlates with poor prognosis and immune infiltration in pancreatic cancer. Cancer Med. 2023;12(4):5110–23.
39.
Cao R, Wang K, Long M, Guo M, Sheng L, Zhan M, et al. miR-3613-5p enhances the metastasis of pancreatic cancer by targeting CDK6. Cell Cycle. 2020;19(22):3086–95.
40.
Lieber M, Mazzetta J, Nelson-Rees W, Kaplan M, Todaro G. Establishment of a continuous tumor‐cell line (PANC‐1) from a human carcinoma of the exocrine pancreas. Int J Cancer. 1975;15(5):741–7.
41.
Chen W, Horoszewicz J, Leong S, Shimano T, Penetrante R, Sanders W, et al. Human pancreatic adenocarcinoma: in vitro and in vivo morphology of a new tumor line established from ascites. Vitro Cell Dev Biology-Plant. 1982;18(1):24–34.
42.
Loukopoulos P, Kanetaka K, Takamura M, Shibata T, Sakamoto M, Hirohashi S. Orthotopic transplantation models of pancreatic adenocarcinoma derived from cell lines and primary tumors and displaying varying metastatic activity. Pancreas. 2004;29(3):193–203.
43.
Satake T, Suetsugu A, Nakamura M, Hasegawa K, Kunisada T, Shimizu M, et al. Differential organ-targeting and cellular characteristics of metastatic human pancreatic cancer cell lines in mouse models. Anticancer Res. 2018;38(4):1927–35.
44.
Takahashi H, Chen MC, Pham H, Matsuo Y, Ishiguro H, Reber HA, et al. Simultaneous knock-down of Bcl-xL and Mcl-1 induces apoptosis through Bax activation in pancreatic cancer cells. Biochim et Biophys Acta (BBA)-Molecular Cell Res. 2013;1833(12):2980–7.
Statements and Declarations
A
Funding
The authors declare that no funds or grants were received for this manuscript.
Competing Interests
The authors declare that they have no competing interests.
A
Author Contribution
Ehsan Arefian and Zohreh Haghri performed the analysis. The original draft was written by Zohreh Haghri, and writing–review & editing were done by Ehsan Arefian. Nasrin Motamed and Mahdi Karimi contributed to the investigation. All authors read and approved the final manuscript
A
Data Availability
The data used in this study have been archived and are available upon request by the corresponding author.
Total words in MS: 3964
Total words in Title: 21
Total words in Abstract: 235
Total Keyword count: 6
Total Images in MS: 6
Total Tables in MS: 2
Total Reference count: 44