A
Rapid visual detection of Treponema pallidum using the RPA-CRISPR/Cas12a SystemWenruiLi1
YuanzhongSun1
MinnanYe2
YuemeiLiang1
JinyiOuyang1
WenjieXu1
YuguiSu1
DexinNie3
XueqinHuang4
SuidongOuyang3,4✉Emailouyangsd@gdmu.edu.cn
1Dongguan Key Laboratory for Precision Diagnosis and Treatment of Infectious Diseases, Clinical Laboratory Medicine DepartmentDongguan Ninth People’s Hospital523016DongguanChina
2Clinical Laboratory Medicine DepartmentDongguan Eighth People’s Hospital523321DongguanChina
3Liaobu Hospital of Dongguan City523430DongguanChina
4Guangdong Provincial Key Laboratory of Medical Immunology and Molecular Diagnostics, The First Dongguan Affiliated HospitalGuangdong Medical University523808DongguanChina
Wenrui Li1*, Yuanzhong Sun1*, Minnan Ye2*, Yuemei Liang1, Jinyi Ouyang1, Wenjie Xu1, Yugui Su1, Dexin Nie3, Xueqin Huang4, Suidong Ouyang3,4#
1. Dongguan Key Laboratory for Precision Diagnosis and Treatment of Infectious Diseases,, Clinical Laboratory Medicine Department, Dongguan Ninth People's Hospital, Dongguan, 523016, China.
2. Clinical Laboratory Medicine Department, Dongguan Eighth People's Hospital, Dongguan, 523321, China.
3. Liaobu Hospital of Dongguan City, Dongguan 523430, China
4. Guangdong Provincial Key Laboratory of Medical Immunology and Molecular Diagnostics, The First Dongguan Affiliated Hospital, Guangdong Medical University, Dongguan 523808, China
# Correspondence: Suidong Ouyang, ouyangsd@gdmu.edu.cn;
Wenrui Li, Yuanzhong Sun and Minnan Ye contributed equally to this work.
A
Abstract
Syphilis, caused by Treponema pallidum, is a sexually transmitted infection that has re-emerged globally over the past decade, posing significant public health challenges. Conventional diagnostic methods are limited by lengthy processing times, operational complexity, and moderate sensitivity, highlighting the urgent need for rapid, sensitive, and user-friendly detection strategies. In this study, we developed a visual detection platform for T. pallidum DNA by integrating recombinase polymerase amplification (RPA) with CRISPR/Cas12a technology. The assay can be completed within one hour, with results directly interpreted via fluorescence readout. It demonstrated a detection limit as low as 11.34 copies/µL and high specificity, accurately distinguishing T. pallidum without cross-reactivity with common blood-borne pathogens, including HIV, HBV, HCV, and DENV. Validation with clinical samples showed complete concordance with standard diagnostic outcomes. To enhance suitability for point-of-care applications, the RPA-CRISPR/Cas12a system was further adapted to a lateral flow assay (LFA) format, achieving a detection sensitivity of 5.56×10² copies/µL while minimizing reliance on specialized instrumentation. Overall, this platform provides a rapid, sensitive, and robust approach for point-of-care syphilis diagnosis and offers a reference framework for detecting other pathogenic organisms.
Keywords:
Treponema pallidum
recombinase polymerase amplification
CRISPR/Cas12a
Visualization detection
Introduction
Syphilis, a sexually transmitted infection (STI) caused by the spirochete Treponema pallidum subsp. pallidum has undergone a significant global resurgence in recent decades [1, 2]. Since the early 2000s, syphilis incidence has risen markedly worldwide, exacerbating the overall burden of STIs and posing substantial challenges to public health infrastructure and socioeconomic stability [3]. Epidemiological data indicate that approximately 8 million new syphilis cases were reported globally in 2022, with congenital syphilis cases alone reaching an alarming 1.5 million in 2023. These figures underscore persistent gaps in transmission prevention, maternal screening, and neonatal care [4]. Early detection and timely treatment are essential for mitigating mortality, averting severe sequelae, and enhancing long-term patient outcomes and quality of life [5].
Current syphilis diagnosis predominantly relies on serological antibody assays, categorized into non-treponemal tests (NTTs) and treponemal tests (TTs) [6]. NTTs detect immunoglobulin M and G antibodies against lipids released from damaged host cells or cardiolipin components of T. pallidum [7]. Their sensitivity varies by disease stage, ranging from 62%-78% in primary and late syphilis to 97%-100% in secondary syphilis [8, 9]. Despite their simplicity and cost-effectiveness, which facilitate widespread use in screening programs, NTTs are susceptible to false positives in conditions such as pregnancy, autoimmune disorders, and concurrent infections. In contrast, TTs-including the Treponema pallidum particle agglutination assay (TPPA), Treponema pallidum hemagglutination assay (TPHA), enzyme-linked immunosorbent assay (ELISA), and chemiluminescence immunoassay (CLIA)-target antibodies against T. pallidum-specific antigens, providing superior sensitivity and specificity [10, 11]. These assays are particularly effective for confirmatory diagnosis in early syphilis, addressing NTT limitations during this phase [12]. However, a key drawback of TTs is their inability to distinguish between active and resolved infections, as anti-treponemal antibodies often persist lifelong, rendering them unsuitable for monitoring treatment efficacy or disease activity.
To enhance diagnostic precision, molecular approaches such as Treponema pallidum polymerase chain reaction (TP-PCR) have been developed, targeting genomic loci including polA [13], tp47 [14], and 23S rRNA [15]. Among these, polA and tp47 are the most commonly validated and implemented targets in clinical laboratories worldwide. Although TP-PCR offers high accuracy, its adoption is constrained by requirements for specialized equipment, technical expertise, and elevated costs [16]. Consequently, there remains a critical need for rapid, sensitive, specific, and accessible diagnostic tools to bolster syphilis control and curb the epidemic.
The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated (Cas) system, initially acclaimed for genome editing, has been adapted for molecular diagnostics [17]. Systems such as CRISPR/Cas12a [18], CRISPR/Cas12b [19], and CRISPR/Cas13a [20] leverage programmable nucleic acid recognition for highly specific target detection, establishing CRISPR-Cas as a versatile platform for nucleic acid-based diagnostics. Complementing this, recombinase polymerase amplification (RPA) enables the isothermal amplification of double-stranded DNA without the need for thermal cycling, yielding abundant amplicons rapidly [21]. Integrating RPA with CRISPR-Cas enhances sensitivity and specificity, facilitating detection of low-abundance targets in resource-limited settings [22]. Relative to traditional PCR methods, RPA-CRISPR/Cas12 platforms offer improved performance while obviating the need for costly instrumentation and advanced facilities. Their adaptability supports diverse readout formats, including fluorescence, lateral flow strips, and naked-eye visualization, making them ideal for point-of-care and field applications [23, 24].
In this study, we describe the development, optimization, and validation of a rapid, highly sensitive, and specific syphilis detection assay based on an RPA-CRISPR/Cas12a platform. Results are interpretable via three modalities: naked-eye observation (NEO), lateral flow assay (LFA), and fluorescence-based detection (FBDA). This approach enables efficient identification of T. pallidum and serves as a foundational framework for advancing point-of-care diagnostics for syphilis and other infectious pathogens.
Materials and methods
Materials and reagents
All nucleic acid sequences used in this study, including the recombinant tp47 plasmid, RPA primers, nucleic acid templates from Human Immunodeficiency Virus (HIV, GenBank: D86068.1), Hepatitis B virus(HBV, GenBank: MT426913.1), Hepatitis C virus (HCV, GenBank: KJ439771.1) and Dengue virus (DENV, GenBank: M14931.2). CRISPR RNAs (crRNAs), the fluorescent ssDNA reporter, and the lateral flow strip reporter, were synthesized by Aiji Biotechnology Co., Ltd. (Guangzhou, China). EnGen® Lba Cas12a (Cpf1) was obtained from New England Biolabs (Ipswich, MA, USA), and TwistAmp® Basic DNA Amplification Kits were purchased from TwistDx Ltd (Cambridge, UK). Tiosbio® Cas12/13-specific nucleic acid test strips were acquired from Beijing Baoying Tonghui Biotechnology Co., Ltd. (Beijing, China). Human serum samples for clinical validation were provided by our institutional laboratory. All procedures involving human specimens were conducted in accordance with the Declaration of Helsinki and approved by the Ethics Review Committee of the Ninth People’s Hospital of Dongguan (Approval No. 3, 2022).
Plasmid construction and copy number calculation
The tp47 gene (GenBank: M88769.1) was selected as the target for syphilis detection and cloned into the pBluescript II SK(-) vector using standard recombinant DNA techniques. Plasmid DNA copy number was determined using the formula: DNA copy number per microliter = [(6.02 x 10^23) x (plasmid concentration, in nanograms per microliter) x 10− 9]/[(fragment length, in nucleotides) x660], where 6.02×10²³ represents Avogadro’s number, and 660 is the average molecular weight of a base pair in Daltons.
CrRNA and RPA primer design
A
CrRNA sequences of 41 nucleotides were designed using CRISPR RGEN Tools (http://www.rgenome.net/cas-designer/). The specificity of each crRNA targeting tp47 was validated via NCBI BLAST. RPA primers were subsequently designed based on the tp47 sequence encompassing the crRNA binding region, following the guidelines in the TwistAmp Assay Design Manual. Three candidate primer pairs were evaluated for specificity using NCBI BLAST, and the optimal primer pair was selected based on amplification efficiency and product size confirmed by agarose gel electrophoresis.Name | Oligonucleotide sequence (5’-3’) |
|---|---|
tp47F1 | GTTCCTCATGAATTAAAAGGGATTGCAAAG |
tp47R1 | AAAAACTATCCTCAGTGAGCATTGTCTTAAGG |
tp47F2 | CGAGGAATACAAGATTACGAACGTAAAGGT |
tp47R2 | CAGAAAAACTATCCTCAGTGAGCATTGTCT |
tp47F3 | TAAGACAATGCTCACTGAGGATAGTTTTTC |
tp47R3 | ACATAGTCGATGAACTCACGGTGCGACAGC |
CrRNA | UAAUUUCUACUAAGUGUAGAU UGCACGUAAGGUAAGCAGCA |
ssDNA-FQ | 6-FAM- TTATT-BHQ1 |
ssDNA-FB | 6-FAM- TTATT-Biotin |
RPA amplification
RPA was performed using the TwistAmp® Basic Kit following the manufacturer’s instructions. The reaction mixture (total volume 47.5 µL) comprised 29.5 µL resuspension buffer, 2.4 µL each of forward and reverse primers (10 µM), 1 µL target nucleic acid template, and one enzyme pellet, with nuclease-free water added to reach the final volume. After thorough mixing, 2.5 µL of magnesium acetate (280 mM) was added to initiate the reaction. The mixture was briefly centrifuged and incubated at 39°C for 30 minutes.
Fluorescence detection assay based on RPA-CRISPR/Cas12a
For fluorescence-based detection, 10 µL of the RPA-amplified product was combined with 100 nM crRNA, 100 nM EnGen Lba Cas12a (Cpf1; New England Biolabs, USA), 100 nM fluorescent reporter probe and 1× NEBuffer 2.1 in a total volume of 30 µL. The mixture was incubated at 37°C for 30 minutes. Fluorescence was monitored in real time at 1-minute intervals using a real-time PCR system (Applied Biosystems). Fluorescence was also visualized under blue light (470 nm) using a Tanon MINI Space 1000 Gel Imaging System after reaction completion.
Lateral flow assay based on RPA-CRISPR/Cas12a
For lateral flow detection, the RPA amplification and CRISPR/Cas12a reaction were performed as described above, except that the reporter probe was labeled with FAM and biotin. Following the reaction, the mixture was diluted with 70 µL of ddH₂O, and a lateral flow strip was inserted into the tube. Results were interpreted visually within 10 minutes.
Evaluation of sensitivity and specificity
The sensitivity of the RPA-CRISPR/Cas12a detection system was assessed using serial dilutions of recombinant tp47 plasmid ranging from 1 ng/µL to 1 fg/µL, prepared with nuclease-free water. Nuclease-free water alone served as the no-template control (NTC). The specificity of the assay was evaluated by testing nucleic acids from HIV, HBV, HCV, and DENV, which can present clinical symptoms similar to Treponema pallidum infection, following the detection procedures described above.
Clinical sample evaluation
A total of 18 serum samples from patients with suspected syphilis were analyzed using the RPA-CRISPR/Cas12a assay. The true status of each specimen was blinded to the operator during testing, and the minimum detection limit of the assay was applied as the threshold for a positive result. Following completion of the assays, the samples were unblinded, and the results were compared with the clinical diagnosis for evaluation.
Statistical analysis
All experiments were performed in triplicate, and data are presented as mean ± standard deviation (SD). Statistical comparisons were conducted using unpaired t-tests with GraphPad Prism 9. Differences were considered statistically significant at *P < 0.05, **P < 0.01, and ***P < 0.001.
Results
Assay workflow and primer optimization for the tp47-targeted RPA-CRISPR/Cas12a rapid visual detection of T. pallidum
The working principle of the RPA-CRISPR/Cas12a-based T. pallidum visual detection system is illustrated in Fig. 1A. Initially, the target gene fragment is amplified using an RPA kit. At a constant temperature of 39°C, DNA recombinase in the RPA reaction forms nucleoprotein complexes with the oligonucleotide primers. These complexes specifically recognize and bind the complementary target sequences, enabling rapid and exponential amplification of the target DNA within 30 minutes. Following amplification, the Cas12a-crRNA complex is introduced into the system. Guided by crRNA through sequence-specific base pairing, Cas12a binds to the target DNA adjacent to the protospacer adjacent motif (PAM). Upon target recognition, Cas12a is activated and exhibits trans-cleavage activity, nonspecifically cleaving single-stranded DNA reporter probes. Fluorescently labeled ssDNA reporters (FQ) release a detectable fluorescence signal upon cleavage, whereas biotin-labeled ssDNA reporters (FB) facilitate result visualization via lateral flow chromatography. In summary, this system allows versatile readouts of T. pallidum detection, including real-time fluorescence monitoring, direct visual observation under blue light, and lateral flow assay-based interpretation, providing a rapid, sensitive, and instrument-flexible platform for pathogen detection.
Based on previous studies, the tp47 gene of Treponema pallidum was selected as the molecular target for nucleic acid detection. Three pairs of RPA primers were designed and synthesized according to the tp47 gene sequence. Comparative evaluation of amplification efficiency revealed that the F3/R3 primer pair generated products with superior yield and specificity compared to the other primer sets (Fig. 1B). Consequently, the F3/R3 primers were selected for all subsequent RPA amplification experiments.
Fig. 1
RPA-CRISPR/Cas12a detection principle and primer screening.
(A) The detection principle of the RPA-CRISPR/Cas12a system for the TP detection. (B) Specificity of RPA primers for the tp47 gene was visualized by 1% agarose gel electrophoresis (P1:F1R1, P2:F2R2, P3:F3R3).
Feasibility evaluation of the RPA–CRISPR/Cas12a-based rapid visual detection system
A
To experimentally validate the system, five reaction conditions were established (R1-R5), each lacking a critical component. R1 contained the complete reaction mixture, including the target DNA, Bst DNA polymerase, Cas12a, and crRNA, whereas R2-R5 omitted the target DNA, Bst DNA polymerase, Cas12a, or crRNA, respectively. lateral flow test (LFT) results corroborated the fluorescence assays. A distinct test line (T-line) was visible only in R1, whereas R2-R5 displayed no T-line (Fig. 2A). This outcome reflects the fact that Cas12a trans-cleavage of the dual-labeled reporter probe (FAM/Biotin) occurs only when both amplification and Cas12a-crRNA targeting are functionally intact. Similarly, only R1 exhibited robust fluorescence under UV illumination, while R2-R5 showed no detectable or negligible background signal (Fig. 2C). Real-time fluorescence monitoring further confirmed these observations: a significant signal increase was observed exclusively in R1, whereas all incomplete reaction groups remained at baseline levels (Fig. 2B). The absence of fluorescence in R2-R5 is consistent with the mechanistic requirement that Cas12a activation depends on both sequence-specific recognition by the crRNA-Cas12a complex and the presence of amplified target DNA. Collectively, these results demonstrate that the RPA-CRISPR/Cas12a system achieves highly specific detection of T.pallidum, with negligible risk of false-positive signals. The consistency across fluorescence assays, real-time monitoring, and lateral flow readouts underscores the robustness and reliability of this platform.Fig. 2
Feasibility analysis of the RPA-CRISPR/Cas12a system for T.pallidum detection
(A) Feasibility analysis of the RPA-CRISPR/Cas12a-LFT system for TP detection. “+” and “−” represent the “presence” and “absence” of the corresponding components in each reaction, respectively. (B). Real-time fluorescence curves caused by isothermal amplification with five reactions (R1-R5) for the detection of the tp47 gene. (C) Fluorescence images of five reactions (R1-R5) with various components were captured using a scanner.
Optimization of reaction parameters for the RPA-CRISPR/Cas12a system
To maximize the detection performance of the RPA-CRISPR/Cas12a assay, key experimental parameters-including RPA amplification time, Cas12a concentration, crRNA concentration, and ssDNA reporter concentration- were systematically optimized. RPA amplification time was first evaluated, as it directly influences the yield of target DNA. Fluorescence intensity increased progressively within the first 30 minutes of amplification and reached a plateau thereafter. This trend was consistent with lateral flow strip readouts, where band intensity stabilized beyond 30 minutes. Therefore, an incubation time of 30 minutes was selected for subsequent RPA reactions (Fig. 3A-C). Next, the concentrations of Cas12a and crRNA were optimized to enhance trans-cleavage activity. Cas12a was tested at final concentrations of 25, 50, 100, 200, and 250 nM, while crRNA was assessed at 50, 100, 200, 250, and 500 nM. The strongest fluorescence signals were observed with 100 nM Cas12a and 250 nM crRNA, which were thus determined to be the optimal working concentrations (Fig. 3D-I). Finally, the concentration of the ssDNA reporter was optimized to ensure clear fluorescence detection and unambiguous interpretation of lateral flow strip results. Reporter concentrations ranging from 100 nM to 500 nM were tested. A concentration of 200 nM yielded the most distinct and reproducible results in both fluorescence-based and lateral flow assays, and was therefore selected as the standard condition for subsequent experiments (Fig. 3J). Collectively, these optimizations established a robust set of working parameters, ensuring both high sensitivity and reliable readout of the RPA-CRISPR/Cas12a detection platform.
Fig. 3
Optimization of reaction parameters for the RPA-CRISPR/Cas12a system
(A) Real-time fluorescence curves of RPA reactions at different reaction times in the presence of target DNA (5.56×105 copies/µL recombinant plasmid tp47). (B) Fluorescence of different RPA reactions at times ranging from 0 min to 40 min. (C) Optimization of the RPA reaction times for the RPA-CRISPR/Cas12a-LFT detection system (5.56×105 copies/µL recombinant plasmid tp47 as target DNA). (D) Real-time fluorescence curves of Cas12a at different concentrations in the presence of target DNA (5.56×106 copies/µL recombinant plasmid tp47 as target DNA). (E) The fluorescence value of RPA-CRISPR/Cas12a with various concentrations of Cas12a (5.56×106 copies/µL recombinant plasmid tp47 as target DNA). (F) Optimization of the Cas12a concentrations for the RPA-CRISPR/Cas12a-LFT detection system (5.56×106 copies/µL recombinant plasmid tp47 as target DNA). (G) The fluorescence value of RPA-CRISPR/Cas12a with various concentrations of CrRNA (5.56×106 copies/µL recombinant plasmid tp47 as target DNA). (H) Real-time fluorescence curves of CrRNA at different concentrations in the presence of target DNA (5.56×106 copies/µL recombinant plasmid tp47 as target). (I) Optimization of the CrRNA concentrations for the RPA-CRISPR/Cas12a-LFT detection system (5.56×106 copies/µL recombinant plasmid tp47 as target DNA). (J) Optimization of the ssDNA concentrations for the RPA-CRISPR/Cas12a-LFT detection system (5.56×106 copies/µL recombinant plasmid tp47 as target DNA).
Sensitivity and specificity evaluation of the RPA-CRISPR/Cas12a fluorescence assay
Under optimized reaction conditions, the sensitivity of the RPA-CRISPR/Cas12a assay was evaluated using serial dilutions of the tp47 plasmid ranging from 1 fg/test to 1 ng/test. Fluorescence intensity increased proportionally with target DNA concentration within this range. A strong linear correlation was observed between the fluorescence signal and the logarithm of target concentration across 10 fg/test to 100 pg/test, with a correlation coefficient (R²) of 0.99 (Fig. 4A-C). Based on three independent negative control (NC) measurements, the limit of detection (LOD) was calculated as 2.04 fg/test (equivalent to 11.34 copies/µL, determined using DNA copy number conversion). The specificity of the assay was further assessed using the tp47 gene fragment alongside nucleic acids from clinically relevant pathogens that present with overlapping symptoms, including HIV, HBV, HCV, and DENV. Robust fluorescence signals were generated exclusively in the presence of the tp47 target, while non-target viral samples and negative controls showed no detectable or negligible signal in both real-time and endpoint fluorescence measurements (Fig. 4D-E). Notably, at a target concentration of 1 ng/test, signal intensity for tp47 was markedly higher than for all non-target controls, underscoring the high specificity of the system and its capacity to reliably distinguish T. pallidum from other pathogens.
Fig. 4
Methodological evaluation of RPA-CRISPR/Cas12a based on fluorescence detection.
(A) Real-time fluorescence curve detected from the RPA-CRISPR/Cas12a System for recombinant plasmid tp47 at different concentrations ranging from 1 fg/test to 1 ng/test (5.56 copies/ul-5.56×106 copies/ul). (B). Fluorescence images of eight reactions (R1-R8, R1: 1 ng/test, R2: 100 pg/test, R3: 10 pg/test, R4: 1 pg/test, R5: 100 fg/test, R6: 10 fg/test, R7: 1 fg/test, R8: NC.) were captured using a scanner. (C) Linear relationship between the fluorescence and the logarithm of target DNA concentrations. Error bars represent standard deviation, n = 3. (D) Real-time fluorescence curves detected from the RPA-CRISPR/Cas12a System for TP, HIV, HBV, HCV, and DENV. (E) Photograph (top) and bar graph depicting fluorescence intensity for TP, HIV, HBV, HCV, and DENV.
Sensitivity and specificity evaluation of the RPA-CRISPR/Cas12a LFT assay
To improve the practicality of the assay in resource-limited settings, a LFT-based detection platform was established. This method combines the high sensitivity and operational simplicity of lateral flow assays, eliminating the need for specialized equipment. In this system, the ssDNA reporter was dual-labeled with FAM and biotin. The LFT strip was composed of a conjugate pad (pre-coated with anti-FAM antibodies conjugated to gold nanoparticles), a detection zone containing streptavidin (test line) and IgG (control line), and an absorbent pad. Upon application of the RPA–CRISPR/Cas12a reaction product, intact ssDNA reporters were captured at the control line via streptavidin binding. In the presence of the tp47 target, Cas12a was activated and cleaved the reporter, releasing fragments that were subsequently captured at the test line, resulting in two distinct visible bands. The limit of detection (LOD) for the LFT-based assay was determined to be 100 fg/test (5.56×10² copies/µL). The specificity was fully consistent with that observed in the fluorescence-based assay, enabling clear discrimination of tp47 from non-target viral pathogens (Fig. 5A-B). These findings confirm that the LFTs platform provides a rapid, instrument-free, and highly specific approach for T. pallidum detection.
Fig. 5
Methodological evaluation of RPA-CRISPR/Cas12a based on lateral flow test strips detection.
(A) Sensitivity analysis of the RPA-CRISPR/Cas12a-LFTs detection system (1:ng/test, 2:100 pg/test, 3:10 pg/test, 4:1 pg/test, 5:100 fg/test, 6:10 fg/test, 7:1 fg/test, 8:NC). (B) Specificity analysis of the RPA- CRISPR/Cas12a-LFTs detection system (1:TP, 2:HIV, 3:HBV, 4:HCV, 5:DENV, NC).
Clinical validation
To assess the diagnostic efficacy of the developed system, 18 identified clinical serum samples were analyzed using the fluorescence-based RPA–CRISPR/Cas12a assay. The cut-off threshold was defined as three times the maximum fluorescence value of the negative controls. All 18 samples generated detectable fluorescence signals, among which 9 samples (ST1, ST2, ST3, ST4, ST7, ST9, ST10, ST11, and ST13) exceeded the positivity threshold and were identified as syphilis-positive (Fig. 6A). Following unblinding, clinical diagnoses were used as the reference standard, yielding a diagnostic accuracy of 94.4% (Table.2).
To further evaluate the field applicability, the LFT-based RPA–CRISPR/Cas12a assay was applied to the same set of samples. Among them, only ST1 was detected as positive, whereas the remaining samples were negative (Fig. 6B). Quantification of ST1 DNA concentration, based on the established standard curve, indicated 165.96 fg/test, which is above the detection limit of the LFT method. These findings suggest that while the fluorescence-based assay offers high diagnostic accuracy, the current LFT platform is limited by lower sensitivity. Further optimization of strip materials and manufacturing processes will be essential to improve detection performance and enable reliable on-site screening applications.
Fig. 6
Performance of the RPA-CRISPR/Cas12a system in clinical sample detection.
(A) Fluorescence results of RPA-CRISPR/Cas12a for the detection of syphilis. The fluorescence signal was detected by the CRISPR/Cas12a system for 30 min. NC: Negative Control. (B) LFTs results of RPA-CRISPR/Cas12a for the detection of syphilis. The DNA from 18 serum samples was extracted and amplified with RPA for 30 min.
Clinically practical diagnosis | Diagnostic accuracy | ||||
|---|---|---|---|---|---|
illness | Health | total | |||
RPA- CRISPR Cas12a (fluorescence) | Positive | 9 | 0 | 9 | 94.4% |
Negative | 1 | 8 | 9 | ||
total | 10 | 8 | 18 | ||
Discussion
In this study, we developed an RPA–CRISPR/Cas12a detection system for the rapid diagnosis of syphilis. Over the past two decades, the incidence of syphilis has steadily increased, and its diverse clinical manifestations—often overlapping with other infections—pose significant challenges to accurate diagnosis and timely treatment [26]. Currently, syphilis detection relies primarily on combined serological testing (Treponema pallidum-specific and non-Treponema pallidum assays), which serves as a standard approach for screening, diagnosis, and monitoring disease progression and treatment efficacy. Nucleic acid amplification assays, such as conventional PCR, provide direct detection of T. pallidum DNA [6]. For instance, Zhou et al. employed both conventional PCR and droplet digital PCR to detect spirochete DNA in plasma samples from patients at different stages of syphilis, demonstrating high detection efficiency [27]. However, PCR-based methods require expensive instrumentation and trained personnel, limiting their utility for large-scale screening, particularly in resource-limited or grassroots settings.
Compared with traditional amplification methods, the RPA-CRISPR/Cas12a system offers a simpler workflow and requires minimal equipment, significantly reducing both detection cost and turnaround time. These advantages facilitate on-site pathogen detection. The tp47 gene has been widely selected as a target for T. pallidum detection in previous studies [28]. tp47 encodes a cytoplasmic membrane protein involved in cell wall synthesis, making it a stable and specific target for nucleic acid-based assays [29]. RPA is an isothermal amplification technique that has gained popularity due to its rapid amplification, high sensitivity, and operational simplicity. Nonetheless, RPA is prone to primer-dimer formation and nonspecific amplification [30]. CRISPR/Cas12a, as a molecular detection tool, overcomes some of these limitations through its trans-cleavage activity: upon recognition and binding of crRNA to a complementary double-stranded DNA target, Cas12a is activated and cleaves fluorescent reporter probes, releasing a detectable signal. Several RPA–CRISPR/Cas12a-based viral detection assays have been reported. For example, Li et al. developed two RPA-based assays for monkeypox virus: a fluorescence-based RPA (F-RPA) with an LOD of 15.32 copies/µL, and a vertical flow bar RPA (VF-RPA) with an LOD of 8.53 copies/µL [32]. Ren et al. reported an RPA–CRISPR/Cas12a dengue virus assay with an LOD of 91.7 copies/test [33], while Lin et al. described a rapid detection method for Plasmodium parasites, achieving an LOD of 1 copy/µL [34]. These studies, together with our findings, demonstrate that RPA–CRISPR/Cas12a assays are versatile and effective for detecting both viral genomes and more complex bacterial genomes such as T. pallidum. To facilitate syphilis diagnosis in resource-limited regions and low-income countries, we integrated the RPA–CRISPR/Cas12a detection system with lateral flow assay (LFA) technology, enabling point-of-care testing without reliance on large laboratory instruments. This approach enhances accessibility and scalability for field diagnostics.
Despite these advantages, the RPA–CRISPR/Cas12a system has several limitations. First, the LOD of LFA-based detection is generally higher than that obtained with fluorescence-based detection, as fluorescence readouts are quantified using sensitive PCR instrumentation. Second, to minimize RPA aerosol contamination, electrophoretic verification of amplification products is typically omitted, preventing confirmation of amplicon size. Third, the design and validation of RPA-CRISPR/Cas12a assays remain technically demanding and require careful optimization of primers, crRNAs, and reaction conditions. While costs can be reduced through large-scale implementation, they must be considered during assay development.
Conclusions
In summary, we have successfully established and validated a rapid, sensitive, and specific nucleic acid visual detection platform for T. pallidum based on the integration of RPA and CRISPR/Cas12a. The system supports dual readout modalities: a fluorescence-based assay and an LFB-based assay, both demonstrating high specificity and sensitivity with no observed false-positive results. The fluorescence-based method achieved a limit of detection (LOD) of 2.04 fg/test, while the LFB-based approach exhibited an LOD of 10 fg/test. Collectively, the RPA-CRISPR/Cas12a platform offers a robust, efficient, and user-friendly tool for syphilis diagnosis. Its minimal equipment requirements, rapid turnaround, and adaptability to point-of-care formats highlight its strong potential for deployment in resource-limited settings and for large-scale screening applications.
Acknowledgements
Not applicable.
A
Author Contribution
W. L. and S. O. were responsible for conceptualizing the research. W. L., Y.S., and S. O devised the methodology. Y. S., M.Y., J.O., W.X., Y.S.,D.N and X.H. carried out the formal analysis and investigation. The original draft of the manuscript was prepared by W. L., Y. S., and M.Y. Subsequently, the writing process underwent review and editing by S. O. W.L. and S. O. secured the funding for this project. S. O. supervised the overall study. Each author participated in revising the manuscript and lent their approval to the final version.
A
Funding
This work was supported by the Dongguan Science and Technology of Social Development Program (20221800905392, 20231800940452, 20231800940112, 20221800906092), National Natural Science Foundation of China (82370039), Guangdong Basic and Applied Basic Research Foundation (2024A1515140157), Science and Technology Special Envoy Project of Songshan Lake District of Dongguan City (20234404-01KCJG), Songshan Lake Medical and Engineering Integration Project (4SG22310P), the Innovation Project for College Students (2JD24101, 2DC24103G, JDXM2024041).
A
Data Availability
The datasets analysed during the current study are available in the [NCBI] repository, [M88769.1, D86068.1, MT426913.1, KJ439771.1, M14931.2].
Declarations
Ethics approval and consent to participate
A
The study protocol complied with the ethical guidelines of the Declaration of Helsinki and was approved by the Ethics Review Committee of the Ninth People’s Hospital of Dongguan (Ethics Review No. 3, 2022). Written informed consent was obtained from all participants prior to enrollment.Clinical trial number
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
References
1.
Satyaputra, F., Hendry, S., Braddick, M., Sivabalan, P. & Norton, R. The Laboratory Diagnosis of Syphilis. J. Clin. Microbiol. 59 (10), e0010021. 10.1128/jcm.00100-21 (2021).
2.
O'Connor, N. P. et al. Outcomes After Positive Syphilis Screening. Pediatrics 150 (3). 10.1542/peds.2022-056457 (2022).
3.
Peeling, R. W., Mabey, D., Chen, X. S., Garcia, P. J. & Syphilis Lancet (London England) ;402(10398):336–346 ; doi: 10.1016/s0140-6736(22)02348-0. (2023).
4.
Bourchier, L., Goller, J. & Bittleston, H. Detecting asymptomatic syphilis. Lancet Reg. health Western Pac. 40, 100901. 10.1016/j.lanwpc.2023.100901 (2023).
5.
Sweitzer, S., Duncan, J. A. & Seña, A. C. Update on syphilis diagnostics. Curr. Opin. Infect. Dis. 38 (1), 44–53. 10.1097/qco.0000000000001073 (2025).
6.
Talhari, C., Arriel, K., Serra, M. S. & Veasey, J. V. Acquired syphilis: update on clinical, diagnostic and therapeutic aspects(⋆). Bras. Dermatol. 100 (3), 407–421. 10.1016/j.abd.2024.11.002 (2025).
7.
Reis, A. R. P. et al. Reactive treponemal and non-treponemal tests in pregnant women and associated factors. Revista da Escola de Enfermagem da U S P. 56, e20220146. 10.1590/1980-220X-REEUSP-2022-0146en (2022).
8.
Papp, J. R. et al. CDC Laboratory Recommendations for Syphilis Testing, United States, 2024. MMWR Recommendations and reports: Morbidity and mortality weekly report. Recommendations Rep. 73 (1), 1–32. 10.15585/mmwr.rr7301a1 (2024).
9.
Larsen, S. A., Steiner, B. M. & Rudolph, A. H. Laboratory diagnosis and interpretation of tests for syphilis. Clin. Microbiol. Rev. 8 (1), 1–21. 10.1128/cmr.8.1.1 (1995).
10.
Theel, E. S., Katz, S. S. & Pillay, A. Molecular and Direct Detection Tests for Treponema pallidum Subspecies pallidum: A Review of the Literature, 1964–2017. Clin. Infect. Dis. 71 (Suppl 1), S4–s12. 10.1093/cid/ciaa176 (2020).
11.
Haynes, A. M. et al. Evaluation of a minimal array of Treponema pallidum antigens as biomarkers for syphilis diagnosis, infection staging, and response to treatment. Microbiol. Spectr. 12 (1), e0346623. 10.1128/spectrum.03466-23 (2024).
12.
Chittle, A. D., Sandstrom, P., Cox, J. & Tsang, R. S. W. Treponemal point-of-care tests for syphilis. CMAJ: Canadian Medical Association journal = journal de l'Association medicale canadienne. ;196(20):E702–e3 ; (2024). 10.1503/cmaj.231548
13.
Castro, R. et al. Detection of Treponema pallidum Sp. Pallidum DNA in Cerebrospinal Fluid (CSF) by Two PCR Techniques. J. Clin. Lab. Anal. 30 (5), 628–632. 10.1002/jcla.21913 (2016).
14.
Grange, P. A. et al. Use of a Multiplex PCR Assay To Assess the Presence of Treponema pallidum in Mucocutaneous Ulcerations in Patients with Suspected Syphilis. J. Clin. Microbiol. 59 (2). 10.1128/jcm.01994-20 (2021).
15.
Golden, M. et al. Treponema pallidum Nucleic Acid Amplification Testing To Augment Syphilis Screening among Men Who Have Sex with Men. J. Clin. Microbiol. 57 (8). 10.1128/jcm.00572-19 (2019).
16.
Cao, W., Thorpe, P. G., O'Callaghan, K. & Kersh, E. N. Advantages and limitations of current diagnostic laboratory approaches in syphilis and congenital syphilis. Expert Rev. Anti Infect. Ther. 21 (12), 1339–1354. 10.1080/14787210.2023.2280214 (2023).
17.
van Beljouw, S. P. B., Sanders, J., Rodríguez-Molina, A. & Brouns, S. J. J. RNA-targeting CRISPR-Cas systems. Nat. Rev. Microbiol. 21 (1), 21–34. 10.1038/s41579-022-00793-y (2023).
18.
Mao, Z. et al. CRISPR/Cas12a-based technology: A powerful tool for biosensing in food safety. Trends Food Sci. Technol. 122, 211–222. 10.1016/j.tifs.2022.02.030 (2022).
19.
Ming, M. et al. CRISPR-Cas12b enables efficient plant genome engineering. Nat. plants. 6 (3), 202–208. 10.1038/s41477-020-0614-6 (2020).
20.
Gootenberg, J. S. et al. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science 356 (6336), 438–442. 10.1126/science.aam9321 (2017).
21.
Feng, X. et al. Recombinase Polymerase Amplification-Based Biosensors for Rapid Zoonoses Screening. Int. J. Nanomed. 18, 6311–6331. 10.2147/ijn.S434197 (2023).
22.
Tang, G. et al. RT-RPA-Cas12a-based assay facilitates the discrimination of SARS-CoV-2 variants of concern. Sens. actuators B Chem. 381, 133433. 10.1016/j.snb.2023.133433 (2023).
23.
Liu, Q. et al. Development of RPA-Cas12a assay for rapid and sensitive detection of Pneumocystis jirovecii. BMC Microbiol. 24 (1), 314. 10.1186/s12866-024-03440-z (2024).
24.
Tu, Q. et al. Point-of-care detection of Neisseria gonorrhoeae based on RPA-CRISPR/Cas12a. AMB Express. 13 (1), 50. 10.1186/s13568-023-01554-7 (2023).
25.
Li, Y. et al. Establishment of RT-RPA-Cas12a assay for rapid and sensitive detection of human rhinovirus B. BMC Microbiol. 23 (1), 333. 10.1186/s12866-023-03096-1 (2023).
26.
Chan, P. A. & Mena, L. Point-of-Care Syphilis Testing: Implementation and Future Direction. Curr. HIV/AIDS Rep. 22 (1), 28. 10.1007/s11904-025-00728-1 (2025).
27.
Wang, C. et al. Quantified Detection of Treponema pallidum DNA by PCR Assays in Urine and Plasma of Syphilis Patients. Microbiol. Spectr. 10 (2), e0177221. 10.1128/spectrum.01772-21 (2022).
28.
Wang, C. et al. A New Specimen for Syphilis Diagnosis: Evidence by High Loads of Treponema pallidum DNA in Saliva. Clin. Infect. Dis. 73 (9), e3250–e8. 10.1093/cid/ciaa1613 (2021).
29.
Mi, H. F. et al. Association between treatment failure in patients with early syphilis and penicillin resistance-related gene mutations of Treponema pallidum: Protocol for a multicentre nested case-control study. Front. Med. (Lausanne). 10, 1131921. 10.3389/fmed.2023.1131921 (2023).
30.
Srivastava, P. & Prasad, D. Isothermal nucleic acid amplification and its uses in modern diagnostic technologies. 3 Biotech. 13 (6), 200. 10.1007/s13205-023-03628-6 (2023).
A
31.Paul, B. & Montoya, G. CRISPR-Cas12a: Functional overview and applications. Biomedical J. 43 (1), 8–17. 10.1016/j.bj.2019.10.005 (2020).
32.
Li, Y. et al. Development of rapid nucleic acid assays based on the recombinant polymerase amplification for monkeypox virus. Virol. Sin. 38 (1), 165–170. 10.1016/j.virs.2022.12.001 (2023).
33.
Zhang, Y. et al. A one-pot method for universal Dengue virus detection by combining RT-RPA amplification and CRISPR/Cas12a assay. BMC Microbiol. 25 (1), 163. 10.1186/s12866-025-03882-z (2025).
34.
Wei, H. et al. Rapid and Ultrasensitive Detection of Plasmodium spp. Parasites via the RPA-CRISPR/Cas12a Platform. ACS Infect. Dis. 9 (8), 1534–1545. 10.1021/acsinfecdis.3c00087 (2023).