Muara Enim Regency is one of the regions in South Sumatra Province that is actively engaged in the agricultural sector, with the area allocated for food crops and horticulture reaching 79.02% (Safety et al. 2024). One of the leading agricultural commodities extensively cultivated in this region is the duku fruit (Lansium domesticum). According to data from the Central Statistics Agency (2018), the duku commodity in Muara Enim Regency has experienced a fluctuating yet overall increasing trend over the past three years, as reflected in the total harvested area: 96.34 hectares in 2015, a decrease to 50.06 hectares in 2016, followed by a significant increase to 392.54 hectares in 2017. In general, duku trees in Muara Enim are intercropped with other fruit species such as durian, mango, mangosteen, and other fruit-bearing plants. Most duku orchards in the region are inherited from previous generations, as duku trees are known for their longevity, with some trees exceeding 100 years of age. The duku tree also holds potential as an alternative species for urban greening initiatives, particularly in office areas, due to its long lifespan, making it suitable for supporting both aesthetic and ecological functions within long-term greening programs (Atmojo et al. 2018). From an economic standpoint, the development of duku seedling enterprises presents considerable potential for enhancing local livelihoods through the provision of superior-quality seedlings produced via grafting techniques. This method enables the generation of high-quality seedlings characterized by early fruiting and high market value (Sulistyantara et al. 2024).

The duku plant (Lansium domesticum) is regarded as one of the prominent tropical fruit species highly favored by consumers due to its considerable commercial value and rich nutritional composition (Zulaikha et al. 2022). L. domesticum contains various essential vitamins, including B-complex vitamins and pure vitamin C, which exhibit strong antioxidant activity (Konda et al. 2020). The antioxidant compounds present in L. domesticum—such as flavonoids, phenolic compounds, B vitamins, and vitamin C—play a crucial role in mitigating oxidative stress associated with chronic diseases, including diabetes, cancer, and cardiovascular disorders. These antioxidant activities help neutralize free radicals and protect cells from oxidative damage (Abdallah et al. 2022). In the agricultural sector, extracts derived from the fruit peel and seeds of duku have demonstrated potential as botanical insecticides, attributed to the presence of bioactive compounds such as essential oils, steroids, phenolics, tannins, and flavonoids, which exhibit efficacy against armyworms (Spodoptera litura) (Valentino et al. 2023). Furthermore, various secondary metabolites produced by the duku plant have been reported to possess mosquito-repellent properties (Yulianis et al. 2019). Chandra et al. (2023) also reported that duku peel extract exhibits larvicidal activity against Aedes aegypti larvae, resulting in a mortality rate of up to 7%.

Between 2014 and 2017, widespread mortality of duku (Lansium domesticum) trees was reported along the Komering River watershed in Ogan Komering Ulu (OKU) Regency, with disease incidence reaching 100%. The causal agent was identified as Ceratocystis fimbriata (Suwandi et al. 2021). Infections of L. domesticum by Ceratocystis have subsequently spread to several regencies in South Sumatra, including South Ogan Komering Ulu, East Ogan Komering Ulu, Musi Banyuasin, Ogan Komering Ilir, Muara Kelingi, North Musi Rawas, and Muara Enim (Muslim et al. 2022). More recent outbreaks indicate that the disease has become widespread, resulting in total mortality of duku orchards in Muara Enim, which initially involved only a single orchard in 2017. The symptomatology observed in affected trees is consistent with earlier reports, primarily characterized by wilting induced by Ceratocystis infection. Infected trunks exhibited numerous lesions resembling squirrel bite marks, fissured bark, and, upon incision, linear brown-to-black discolorations within the bark that progressively extended into the heartwood (Suwandi et al. 2021). Under severe infection, both disease incidence and intensity reached 100% within only four to five months following symptom onset. In most cases, initial infection sites were associated with wounds attributed to squirrel feeding, which facilitated pathogen entry. Moreover, the presence of ambrosia beetles further exacerbated disease dissemination (Muslim et al. 2025). Ceratocystis species are recognized as aggressive pathogens of perennial crops, capable of causing significant damage. Infected hosts may experience reductions in volumetric growth of up to 87%, cellulose yield losses of 13.7%, and a marked decline in wood quality (Benso et al. 2024). Ceratocystis fimbriata colonizes the xylem vessels as well as both the outer and inner bark tissues of infected trees (Carluccio et al. 2023). Its presence leads to severe wilt symptoms in susceptible hosts (Ahmad et al. 2022). Members of the genus Ceratocystis are known to infect a wide range of perennial crops and are frequently transmitted by insect vectors, with fungal development facilitated through wounds on host tissues (Rahayu et al. 2015).

Globally, Ceratocystis has become widely distributed and has caused significant damage, particularly to agroforestry crops. In Brazil, Ceratocystis infection in Eucalyptus has resulted in economic losses estimated at US$3,478.43 per hectare (Fernandes and Furtado 2014). In Malaysia, infections in Acacia mangium have been reported with incidence rates ranging from 7.5% to 13.6% (Syazwan et al. 2021), while in Ecuador, attacks on Gmelina arborea have led to incidence rates between 7% and 24% (Belezaca-Pinargote et al. 2022). In Indonesia, particularly in South Sumatra, Ceratocystis infections are also widespread. This pathogen has been reported to infect a wide range of plant species, from agroforestry crops to forest trees. Between 2021 and 2023, the incidence of Ceratocystis disease in Swietenia macrophylla (mahogany) in South Sumatra increased markedly from 6.77% to 15.25% (Muslim et al. 2024). A similar pattern was observed in Acacia mangium plantations in Banyuasin, where the incidence reached 100% during the 2022–2024 period (Amelia et al. 2024). In 2021, Anona muricata plants in South Sumatra were also reported to be infected, with incidence rates ranging from 57% to 100% (Pratama et al. 2023). Furthermore, Ceratocystis has been documented infecting Mimusops elengi (Pratama et al. 2021a) and Artocarpus heterophyllus (Pratama et al. 2021b) in the same region. These findings collectively demonstrate that Ceratocystis poses a serious threat to the sustainability of Indonesia’s forestry and plantation sectors. One particularly vulnerable crop is Lansium domesticum (duku), an economically important and culturally significant exotic fruit native to South Sumatra. According to the classification of C. fimbriata based on ITS genotypes (Harrington et al. 2014), isolates of C. fimbriata associated with L. domesticum in South Sumatra belong to three haplotype groups: ITS5, ITS6z, and ITS7b. Consequently, the objective of the present study is to determine the ITS genotypes of C. fimbriata and to assess its pathogenicity as the causal agent of sudden death in L. domesticum. In addition, this study aims to provide updated insights into the geographical distribution of C. fimbriata disease in the Muara Enim region.

Disease Intensity Formula

IP = disease Intensity

n = number of plants affected

N = Total plants observed

Z = Highest score

n0, n1, n2, n3,n4 = The number of plants showing symptoms of stem rot with a score of 1,2,3,4.

The isolates were collected from fresh L. domesticum plants showing symptoms of lesion formation on the sapwood, discoloration of vascular tissues, and partial or total wilting caused by Ceratocystis. Sampling was carried out by making incisions in the bark and cutting longitudinal tangential sections (approximately 50 mm) from the newly infected xylem, which appeared dark brown to black. Lansium domesticum plants used as samples were approximately 20 to 110 years old. The diseased wood samples were wrapped in tissue, placed in plastic bags, and stored in a refrigerator prior to isolation.

Isolation of Ceratocystis was carried out using two methods. The first method was performed by cutting diseased wood samples into pieces measuring 20 × 20 mm. The wood pieces were sterilized by washing the samples in sterile distilled water for 5 minutes, then immersing them in a streptomycin solution for 5 minutes, followed by sodium hypochlorite (NaClO) for 5 minutes, and rinsing again with sterile distilled water. After that, the wood pieces were dried in a laminar airflow cabinet and directly placed on malt extract agar (MEA) medium at room temperature (25°C) for 7–10 days to induce direct sporulation on the MEA medium. The second method used the carrot baiting technique. Diseased wood samples of the same size as previously described were placed between slices of fresh carrot and incubated in a moist chamber at room temperature for six to eight days. A single mass of ascospores that developed at the tips of the ascomata on the wood and carrot slices was transferred onto 2% MEA (20 g/l malt, 20 g/l agar) (Biolab, Midrand, South Africa) in new Petri dishes. The cultures were then incubated for four to six days at 25°C.

Eight isolates were selected to represent each surveyed region affected by the disease, namely C1ME (Ujan Mas Baru), C2ME (Ujan Mas Lama), C3ME (Pinang Belarik), C4ME (Muara Gula Lama), C5ME (Rami Pasai), C6ME (Betung), C7ME (Padang Bindu), and C8ME (Pagar Dewa). Macroscopic observations were carried out by examining the growth characteristics of the isolates on plates as well as their growth rate. Each isolate was replicated ten times and incubated at a temperature of 25°C. Subsequently, the colony diameter was measured every 5 days for 20 days, and the average was calculated. Microscopic observations were conducted by examining the morphology of Ceratocystis isolates using fungal structures cultured on 2% MEA medium and incubated for 10 days at 25°C, using an Olympus CX33 microscope equipped with an Optilab Advance Plus. Samples were prepared by placing the fungal structures on glass slides and observing them under the Olympus microscope. For each isolate, 100 replications were made for the measurement of the length and width of the base and neck of the ascomata, ascospores, basiform conidia, barrel-shaped conidia, and chlamydospores.

Single-spore cultures were prepared from fungal isolates representing each region infected by Ceratocystis. The isolates were cultured in potato dextrose broth (PDB) using 250 mL Erlenmeyer flasks at 25°C for 10 days. Mycelia from the PDB cultures were filtered, air-dried, and ground into fine powder using a mortar and pestle. Genomic DNA was extracted using the YeaStar Genomic DNA Kit (Zymo Research Corporation, Irvine, CA, USA). DNA concentration and purity were determined using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Montchanin, DE, USA). Polymerase chain reaction (PCR) amplification and sequencing were performed for two gene regions: the β-tubulin gene using primers βT1a (TTCCCCCGTCTCCACTTCTTCATG) and βT1b (GACGAGATCGTTCATGTTGAACTC) (Glass and Donaldson, 1995), and the internal transcribed spacer (ITS) region using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). PCR reactions (50 µL) consisted of 20 µL Master Mix (Eppendorf, Hamburg, Germany) containing 25 mM MgCl₂, 0.06 U/µL Taq DNA polymerase, and 0.2 mM of each dNTP, along with 1 µL of each primer, 1 µL DNA template, and 27 µL sterile water. PCR was performed in a C1000 Touch thermal cycler (Bio-Rad, Hercules, CA, USA) under the following conditions: initial denaturation at 94°C for 3 min; 30 cycles of denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 1 min; followed by a final extension at 72°C for 10 min. Amplified products were stored at 10°C and visualized using a Gel Doc XR + system (Bio-Rad, Hercules, CA, USA) to verify product size and quality. Verified PCR products were sent to 1st BASE (Selangor, Malaysia) for Sanger sequencing using the same primer sets. Obtained sequences were compared with Ceratocystis spp. reference sequences from previous studies and aligned with sequences generated in this study using BLASTn searches in GenBank (National Center for Biotechnology Information, Bethesda, MD, USA). Sequence alignments were processed in BioEdit v.7.2 (Hall, 1999). Phylogenetic analyses were conducted using the maximum parsimony (MP) method implemented in MEGA v.7 (Kumar et al. 2016) with 1,000 bootstrap replicates to assess branch support. Tree statistics, including tree length, retention index, and consistency index, were calculated. Ceratocystis variospora was designated as the outgroup, and the ingroup taxa were considered monophyletic.

This study was conducted using eight isolates of C. fimbriata. The isolates were selected to represent regions previously affected by Ceratocystis disease (Table 1). The inoculation was carried out in two stages. The first inoculation was performed by inoculating the isolates onto L. domesticum (duku) seedlings to confirm Koch’s postulates. Two-year-old L. domesticum seedlings were collected from local nurseries in Muara Enim, with stem diameters of 2–3 cm and heights of 50–60 cm. The seedlings were planted in 20 × 20 cm polybags filled with a mixture of soil and manure. All plants were kept in a greenhouse and watered twice daily.The second inoculation test was conducted to determine the host range, using seedlings of plant species that are commonly cultivated or naturally grow around duku orchards, such as Persea americana, Eucalyptus sp., Archidendron bubalinum, Dyera costulata, Pithecellobium jiringa, Durio zibethinus, Parkia speciosa, Mimusops elengi, and Swietenia mahagoni. The plants used for inoculation were six months old, with stem diameters of 2–3 cm and heights of 40–80 cm. These seedlings were collected from the Forest Plant Nursery Center (BPTH) in South Sumatra, planted in 20 × 20 cm polybags filled with cocopeat, and maintained as described in the first experiment.

Inoculation was carried out using isolates that had been grown on 2% MEA medium for 2 weeks. The plant stems were wounded using a sterile cork borer with a diameter of 4 mm, approximately 10 cm above the soil surface. The inoculation points on the stems were surface-sterilized by wiping with cotton soaked in 75% ethanol. Mycelial plugs of each Ceratocystis isolate were taken using a cork borer of the same size (4 mm diameter) and placed into each wound. Each isolate was inoculated into 10 seedlings per plant species with the mycelium facing inward, and the same number of plants were used as controls by applying sterile MEA. All inoculated wounds were covered with moistened sterile tissue paper and wrapped with parafilm (Sigma Aldrich, St. Louis, MO, USA) to minimize contamination and drying. The plants were arranged in a randomized complete block design and maintained in a greenhouse. Disease severity and symptoms were observed daily, and lesion length was measured 60 days after inoculation by opening the inoculation point, peeling the bark above and below the wound, and measuring the lesion length.

Wood pieces showing lesions on duku plants were surface-sterilized and inoculated on MEA, as well as using carrot bait to fulfill Koch’s postulates. The fungal identity was verified based on colony morphology, anamorph, and teleomorph characteristics. Pathogenicity test data were analyzed using the R Studio software package. Furthermore, analysis of variance (ANOVA) and Tukey’s Honestly Significant Difference test were used to determine significant differences in the mean comparisons among different treatments.

In early January 2014, more than 2,000 duku Komering trees were reported dead along the Komering River Basin, Ogan Komering Ulu, South Sumatra. Initial symptoms were observed at the onset of the rainy season in October 2013. Although most affected trees experienced shallow flooding for approximately one month, several trees also exhibited mortality in the absence of inundation, suggesting the involvement of an infectious pathogen. The symptomatic trees showed leaf wilting, accompanied by dark brown to black lesions on the sapwood and heartwood tissues. Based on pathogen identification by Suwandi et al. (2021), the disease was confirmed to be caused by Ceratocystis fimbriata. Between 2019 and 2021, Muslim et al. (2022) reported a widespread occurrence of this disease across major duku production centers in South Sumatra, particularly in Ogan Komering Ulu District, with disease incidence reaching up to 100% in Pengaringan and Kepayang villages. Sporadic outbreaks were also recorded in Musi Banyuasin District (approximately 271 km from the initial outbreak site), resulting in complete tree mortality in Sanga Desa and Tanjung Raya. During 2020–2021, similar symptoms were observed in Ogan Komering Ilir and Muara Enim Districts, albeit with relatively low infection levels (< 12%). In 2021, the disease further expanded to Musi Rawas (40.2%) and North Musi Rawas Districts, with incidence rates reaching up to 56.1% in Beringin Jaya Village. The most recent disease distribution records from 2023 to 2025 indicate new occurrences across several major duku cultivation areas in Muara Enim, including Ujan Mas Baru, Muara Gula Lama, Pinang Belarik, Rami Pasai, Betung, Padang Bindu, and Pagar Dewa. The spread radius of Ceratocystis infection has now extended up to 113 km from the initial outbreak site. Disease severity varied among locations, ranging from moderate to severe, with incidence rates between 48.8% and 100%.

The symptoms of Ceratocystis disease observed since 2014 have remained consistent, typically characterized by wilting of several twigs or branches, followed by defoliation and eventual death of the tree. In many cases, duku (Lansium domesticum) trees exhibit complete wilting leading to mortality within six months after the initial symptoms appear. Common external indicators include peeling bark, cracking, and scars caused by squirrel bites. The presence of squirrels is believed to exacerbate disease dissemination, as these animals frequently gnaw on the trunks and branches of infected trees before moving to healthy ones (Suwandi et al. 2021). Furthermore, numerous small holes are often found on the trunk, suggesting the activity of wood-boring insects, particularly ambrosia beetles. These holes frequently occur around lesion areas, and the presence of the beetles is closely associated with a distinctive banana-like odor produced by the interaction between Ceratocystis fungi and infected duku tissues. One insect strongly suspected to serve as a principal vector of the pathogen is Hypocryphalus mangiferae, a bark beetle native to Southeast Asia. This species has previously been reported as a vector of Ceratocystis manginecans in mango (Mangifera indica) in Oman and Pakistan (Al Adawi et al. 2006, 2013). More recently, it has also been detected infesting duku trees, as evidenced by characteristic boreholes in the wood tissues of infected hosts. Its boring activity is believed to facilitate the dissemination of Ceratocystis propagules from diseased to healthy trees (Syazwan et al. 2021). In addition to H. mangiferae, several other ambrosia beetle species, including Xyleborus affinis and X. simillimus, have been implicated in the transmission of Ceratocystis lukuohia in Metrosideros polymorpha in Hawai‘i (Roy et al. 2020), while Platypus cylindrus has been identified as a vector of Ceratocystis platani in Platanus orientalis in Greece (Soulioti et al. 2015). Scraping the sapwood to the heartwood along wilted sections of the trunk and branches reveals areas of tissue discoloration. The affected sapwood typically exhibits streaked lesions, with coloration ranging from dark brown to black. In some cases, the discoloration extends into the heartwood (vascular tissues).

The severity and distribution pattern of this disease are presumed to be closely associated with the amount of inoculum present in the field. The common practice among duku farmers of leaving dead trees infected by Ceratocystis unremoved serves as a major source of inoculum in affected areas. Extensive colonization of dead duku trees provides an ecological advantage for the fungus, as the aleurioconidia formed within these tissues can act as inoculum dispersed by wind in the form of sawdust particles (Roy et al. 2019). The presence of squirrels that damage trunks and branches by gnawing further facilitates infection entry points. In severely affected orchards, ambrosia beetles are often abundant; their boring activity exacerbates the disease’s spread. In some cases, infection may also originate from the root system and progress upward to the base of the trunk. Root infections are typically triggered by the dissemination of pathogen inoculum through river water, which carries spores to plant tissues, or by planting in locations previously occupied by trees that died from Ceratocystis infection. Orchards situated near rivers tend to exhibit higher disease severity. The degree of disease severity varies across locations. In certain areas, infected plants can survive despite showing symptoms, whereas in others, severe damage is observed. This variation is likely influenced by the genetic diversity of Lansium domesticum and environmental factors such as soil fertility, which affect both host resistance and pathogen development (Hosomi et al. 2012). Pruning practices conducted by farmers further accelerate disease dissemination, as Ceratocystis is a wound-infecting pathogen. The use of contaminated pruning tools on healthy duku trees intensifies the spread of the disease (Chi, Thu, et al. 2019).

The isolates obtained from Muara Enim Regency exhibited morphological characteristics identical to those of Ceratocystis isolates infecting duku (Lansium domesticum) previously reported from several other regencies. The fungal colonies appeared olive gray to dark yellowish brown, with an irregular (filamentous) growth form, and emitted a distinctive banana-like aroma. All isolates produced ascomata in the form of perithecia with elongated necks and ostiolar hyphae diverging at the tips, along with conidiophore (phialide) structures, chlamydospores, hat-shaped ascospores, and cylindrical conidia (Suwandi et al. 2021). Molecular characterization based on ITS and β-tubulin haplotypes revealed a 99% sequence similarity to Ceratocystis fimbriata, thereby confirming the identity of the pathogen. Previous studies have demonstrated that C. fimbriata isolates exhibit sequence variation within the ITS region of rDNA. Suwandi et al. (2021) reported the presence of two major haplotypes, ITS5 and ITS6z, while subsequent research by Muslim et al. (2022) identified additional haplotypes, ITS5 and ITS7b. In the present study, analyses of eight isolates from Muara Enim Regency showed uniformity in ITS sequences, all belonging to haplotype ITS5. This haplotype was also found to be dominant among isolates from seven duku-producing regencies in South Sumatra, suggesting its central role in the local epidemic dynamics. Globally, ITS5 has been reported as the most prevalent haplotype among C. fimbriata sensu stricto isolates from various hosts in Brazil, including Eucalyptus spp., Mangifera indica, and Acacia spp. (Harrington et al. 2014). This genotype has also been identified as part of native populations of C. fimbriata infecting Eucalyptus grandis in Zimbabwe (Jimu et al. 2015) and Acacia spp. in Indonesia and Vietnam (Tarigan et al. 2011; Trang et al. 2018).

According to Harrington et al. (2014), haplotype ITS5 belongs to an interfertile and phylogenetically cohesive group and may serve as a genetic indicator of aggressive C. fimbriata lineages with high dissemination potential through planting material. This inference is further supported by evidence from China, where ITS5 is implicated as the primary causal haplotype in disease outbreaks affecting horticultural crops such as Punica granatum, Colocasia esculenta, and Camellia sinensis (Li et al. 2016a; Li et al. 2016b; Xu et al. 2019). These outbreaks are hypothesized to have originated from the introduction of the pathogen via Eucalyptus cutting trade from Brazil. Collectively, these findings suggest that haplotype ITS5 not only represents a stable genetic structure within local C. fimbriata populations but also constitutes an aggressive and invasive genotype of global epidemiological significance.

Koch’s postulate and pathogenicity assays demonstrated that Ceratocystis fimbriata isolates obtained from duku (Lansium domesticum) exhibited high virulence, with an infection rate of 100%, resulting in progressive wilting and eventual plant death. Highly pathogenic isolates, namely C6ME and C8ME, were capable of inducing extensive stem lesions and caused complete mortality of all inoculated plants within 90 days post-inoculation. The symptomatology observed in the inoculated plants was consistent with field observations, thereby reinforcing the role of C. fimbriata as the primary causal agent of mortality in duku. Artificial inoculation conducted at a distance of 10 cm from the stem base led to the death of the entire plant, with the pathogen capable of vertical movement exceeding 9 cm both upward and downward from the inoculation site. This pattern is characteristic of vascular wilt diseases, in which pathogen spores are passively transported through the xylem sap flow during transpiration (Gibbs, 2001; Green, 1981). A similar mechanism has been reported in Ceratocystis lukuohia infecting ʻōhiʻa (Metrosideros polymorpha), indicating that members of the genus Ceratocystis exploit host transpiration dynamics for systemic dissemination (Hughes et al. 2020). The isolates C6ME and C8ME were identified as belonging to the ITS5 genotype, which is known for its broad host range (Tarigan et al. 2011). The high virulence of ITS5 has also been documented in jackfruit (Artocarpus heterophyllus) (Pratama et al. 2021a) and bullet wood (Mimusops elengi) (Pratama et al. 2021b). Further inoculation experiments on various forest and agroforestry tree species revealed that these isolates exhibit cross-host infectivity, with high pathogenicity toward Parkia speciosa, moderate pathogenicity toward Persea americana, Mimusops elengi, Swietenia mahagoni, and Archidendron pauciflorum, and low pathogenicity toward Durio zibethinus, Pithecellobium jiringa, and Dyera costulata. Observed symptoms included stem lesion development and seedling mortality. Collectively, these findings confirm that C. fimbriata represents a significant and emerging pathogen with a high potential for dissemination across multiple host species. Its occurrence constitutes a serious threat to the sustainability and productivity of duku plantations and poses substantial ecological and economic risks within forest and agroforestry ecosystems in Indonesia.