Ellagic Acid and Montelukast Mitigate Arsenic Trioxide-Induced Hepatotoxicity via Modulation of Oxidative Stress, Inflammatory Pathways, and Mitochondrial Apoptosis
Maryamgharibi1
A
AliAkbarOroojan2
A
MohammadAminBehmanesh3
NedaAmirgholami4
Hoomanetedali1
SoheilaAlboghobeish4✉Phone+98-614-242-8717EmailEmail
SoheilaAlboghobeish.1
1
A
School of Medicine, Student Research CommitteeDezful University of Medical SciencesDezfulIslamic Republic of Iran
2
A
Department of Physiology, School of MedicineDezful University of Medical SciencesDezfulIslamic Republic of Iran
3
A
Department of Histology, School of MedicineDezful University of Medical SciencesDezfulIslamic Republic of Iran
4
A
A
A
Department of Pharmacology, School of MedicineDezful University of Medical SciencesDezfulIslamic Republic of Iran
Maryam gharibia, Ali Akbar Oroojanb, Mohammad Amin Behmaneshc, Neda Amirgholamid, Hooman etedalia, Soheila Alboghobeishd*
a: School of Medicine, Student Research Committee, Dezful University of Medical Sciences, Dezful, Islamic Republic of Iran
b: Department of Physiology, School of Medicine, Dezful University of Medical Sciences, Dezful, Islamic Republic of Iran
c: Department of Histology, School of Medicine, Dezful University of Medical Sciences, Dezful, Islamic Republic of Iran
d: Department of Pharmacology, School of Medicine, Dezful University of Medical Sciences, Dezful, Islamic Republic of Iran
Corresponding author: Soheila Alboghobeish. Department of Pharmacology, School of Medicine, Dezful University of Medical Sciences, Dezful, Islamic Republic of Iran
E-mail: soheila.alb@gmail.com, Alboghobeish.s@dums.ac.ir
Phone: +98-614-242-8717
ORCID ID is 0000-0002-6681-5793
Running title: Ellagic Acid and Montelukast: Protection from Arsenic Trioxide-Induced Hepatotoxicity
Abstract
A
Although arsenic trioxide (As₂O₃) is an effective agent in treating acute promyelocytic leukemia, its use is limited by severe hepatotoxicity primarily mediated through oxidative stress, inflammatory responses, and apoptosis. Ellagic acid (EA) and montelukast (MK) possess protective properties against these damaging processes. This study aimed to investigate the protective effects of EA and MK, individually and in combination, against As₂O₃-induced hepatotoxicity in an experimental mouse model. Forty-two male NMRI mice were divided into seven groups and treated with As₂O₃, EA, MK, or their combinations for 10 days. Following treatment, liver and blood samples were collected, and liver biochemical indices, oxidative stress markers, mitochondrial function, reactive oxygen species (ROS), myeloperoxidase (MPO) levels, expression of inflammatory proteins (TLR4, VCAM-1, MPO), cytokines (TNF-α, IL-1β, IL-6), apoptosis indices (caspase-3, cytochrome c, DNA fragmentation index), and gene expression of Bax, Bcl-2, and Survivin were evaluated. As₂O₃ administration significantly increased liver injury indices, lipid peroxidation, mitochondrial dysfunction, inflammation, and activated apoptotic pathways. Treatment with EA or MK alone showed relative protective effects. Notably, the combination of EA and MK resulted in significant reductions in ALT, AST, MDA, ROS, TNF-α, IL-1β, IL-6, TLR4, VCAM-1, and apoptotic markers. Histopathological examination also revealed improved liver tissue structure in the combination group. The combination of EA and MK exerted potent and multifaceted protective effects against As₂O₃-induced hepatotoxicity by simultaneously targeting oxidative stress, inflammation, and apoptosis. These findings suggest the synergistic efficacy of EA and MK and support their potential as adjuvants to improve tolerability and reduce side effects of As₂O₃ therapy.
Keywords:
Arsenic trioxide
hepatotoxicity
ellagic acid
montelukast
oxidative stress
mitochondria
1. Introduction
A
Arsenic, a metalloid widely distributed in nature, is found mainly in two forms: organic and inorganic. Inorganic arsenic, which is often present in combination with oxygen, chloride, and sulfur, is far more toxic than organic arsenic, which is combined with carbon and hydrogen in plants and animals (Borah, Kumar, & Devi, 2020). Arsenic trioxide (As2O3), with the trade name TRISENOX, is an important chemotherapy drug from the antineoplastic class used for the treatment of acute promyelocytic leukemia (APL), both in newly diagnosed patients and in cases resistant to other treatments (Douer, Hu, Giralt, Lill, & DiPersio, 2003). This drug has demonstrated significant cure rates, reaching up to 90% in patients with relapsed disease (Jiang, Liu, Zheng, & Yin, 2011; List et al., 2003). However, due to the effect of As2O3 on the growth of normal cells in the body, numerous side effects have been reported, including hepatotoxicity, nephrotoxicity, cardiotoxicity (including arrhythmia), and neurological disorders (AU & KWONG, 2008; Yang, Li, Li, & Wang, 2024). As2O3-induced hepatotoxicity is particularly observed in the first week of treatment. It can reduce the therapeutic efficacy of the drug, which raises serious concerns about the management of APL patients treated with As2O3 (Liu et al., 2021).
Numerous studies have demonstrated that the primary mechanism of arsenic toxicity is the production of reactive oxygen species (ROS), leading to oxidative stress (Ganie, Javaid, Hajam, & Reshi, 2024). ROS cause severe cellular damage (including damage to DNA, proteins, and lipids) by altering the activity of critical transcription factors such as activator protein 1 (AP-1), nuclear factor kappa B (NF-κB), and nuclear factor erythroid-related factor 2 (Nrf2), all of which are involved in antioxidant defense (Iqbal et al., 2024). Therefore, the use of compounds with potent antioxidant properties could be very valuable in protecting cells against arsenic-induced oxidative damage (Shiek, Sajai, & Dsouza, 2023).
Flavonoids, including flavones and isoflavones, are a group of natural compounds with antioxidant properties that play an important role in neutralizing ROS due to the presence of hydroxyl groups in their molecular structure (Dias, Pinto, & Silva, 2021). Ellagic acid (EA) (1,3,7,8-tetrahydroxy[1]-benzopyrano[5,4,3-cde][1]benzopyran-5,10-dione), a naturally occurring polyphenol abundant in fruits such as pomegranates and berries, has anti-inflammatory, antifibrotic, antioxidant, hepatoprotective, and chemoprotective properties (Senavirathna, Shafaei, Lareu, & Balmer, 2024). The presence of four hydroxyl groups and two lactones in the structure of ellagic acid increases its ability to combat oxidative stress (Zeb, 2018). Previous studies have confirmed the protective effects of ellagic acid against As2O3-induced cardiotoxicity and neurotoxicity through antioxidant mechanisms (A. Hemmati et al., 2018).
Leukotrienes (LTC4, LTD4, LTE4) are eicosanoid inflammatory mediators derived from the 5-lipoxygenase pathway, playing a key role in bronchoconstriction, airway obstruction, edema, and asthma. Cysteinyl leukotrienes (CysLTs), released by inflammatory cells such as mast cells and eosinophils, enhance inflammation and play a role in liver injury induced by various toxins through increased microvascular permeability and chemotaxis (Butola, Dhok, Ambad, Kanyal, & Jha, 2021). Montelukast, as a selective antagonist of cysteinyl-leukotriene type 1 receptors (CysLT1Rs), has significant anti-inflammatory and antioxidant properties (Lodder, 2011). This drug has shown protective effects on various tissues, including the liver, lungs, kidneys, and heart, by reducing inflammation. Also, administration of montelukast has demonstrated hepatoprotective effects in several experimental models of hepatotoxicity (El-Kashef & Zaghloul, 2022; Pu et al., 2019). Additionally, montelukast enhances the body's antioxidant defenses by increasing levels of antioxidant enzymes and inhibiting ROS (Al-Allaf, 2023; Alnfakh, Al-Mudhafar, Al-Nafakh, Jasim, & Hadi, 2022). Recent studies have also confirmed the cardioprotective effects of montelukast against As2O3 toxicity, with antioxidant mechanisms (A. A. Hemmati et al., 2017)
Considering that liver toxicity caused by As2O3 is one of the main limiting factors in the use of this vital drug, identifying and investigating new protective methods to reduce this side effect seems essential. Since the protective effects of ellagic acid and montelukast have been demonstrated in various models of hepatotoxicity as well as against cardiac, renal, and cerebral toxicity induced by As2O3, This study was designed to investigate the effects of ellagic acid (as a potent antioxidant agent) and montelukast (as an anti-inflammatory and antileukotriene agent) on As2O3-induced hepatotoxicity. This research evaluates these compounds, both individually and in combination with each other. The results of this study, if the protective effects of ellagic acid and montelukast on As2O3-induced hepatotoxicity are confirmed, are expected to be a significant step towards developing new and effective therapeutic strategies to mitigate the side effects of this vital drug. These findings could help improve the quality of life for patients with acute promyelocytic leukemia and other malignancies that require arsenic trioxide treatment, paving the way for future clinical studies and ultimately leading to safer drug formulations.
2. Materials and Methods
2.1. Chemicals
In this study, the highest purity chemicals available were used. Arsenic oxide (As₂O₃), montelukast, ellagic acid ≥ 99% pure, 5,5′-dithiobis-(2-nitrobenzoic acid) (DTNB), 2′,7′-dichlorofluorescein diacetate (DCFH-DA), rhodamine 123, thiobarbituric acid (TBA), trichloroacetic acid (TCA), 1,1,3,3-tetramethoxypropane (TMP), reduced glutathione (GSH), oxidized glutathione (GSSG), Coomassie blue dye, and oligo(dT) primers were purchased from Sigma-Aldrich (St. Louis, MO, USA). Potassium iodide (KI), hydrochloric acid (HCl), HEPES buffer, sucrose, mannitol, EGTA, hydrogen peroxide (H₂O₂), and the compounds used in homogenate preparation were obtained from Merck (Darmstadt, Germany). Enzyme and ELISA kits (including kits for measuring ALT, AST, ALP, SOD, catalase, caspase-3, cytokines, and inflammatory proteins) were obtained from R&D Systems and Abcam. RNA extraction and cDNA synthesis kits were also obtained from Qiagen (Germany), and a qRT-PCR reaction kit from TaKaRa (Japan). All chemicals were stored under standard conditions and used at appropriate temperatures.
2.2. Maintenance and treatment of laboratory animals
A
A
In this experimental study, 42 male NMRI mice weighing 20–25 g were obtained from the Animal Breeding Center of Dezful University of Medical Sciences and maintained under standard conditions. Environmental conditions included a temperature of 21 ± 2°C, a relative humidity of 50%, and a 12-h light cycle. Animals had free access to water and standard food.
A
All animal care and use protocols were carried out by the ethical guidelines of the Ethics Committee of Dezful University of Medical Sciences (IR.DUMS.AEC.1403.013), as well as the EU Directive 2010/63/EU and the NIH Guide for the Care and Use of Laboratory Animals. The study design also complied with the ARRIVE guidelines. Randomization was performed using a computer-generated sequence, and investigators remained blinded to group allocations throughout the outcome measurements.
A
2.2.1 Group Design and Treatment Protocol
After a one-week adaptation period, mice were randomly divided into seven groups of 6 and treated for 10 days:
1.
Control: Daily injection of normal saline (0.9%, intraperitoneal)
2.
As₂O₃: Arsenic trioxide injection (4 mg/kg, i.p.)
3.
Ellagic acid (EA): Oral administration of 30 mg/kg
4.
Montelukast: Oral administration of 20 mg/kg
5.
As₂O₃ + EA: Injection of As₂O₃ along with administration of EA, one hour before
6.
As₂O₃ + Montelukast: Inject As₂O₃ with Montelukast one hour before
7.
As₂O₃ + EA + Montelukast: Combination of all three drugs in the same order
The dose and exposure duration of arsenic trioxide (As₂O₃) in our study were selected based on previous investigations that effectively established hepatic toxicity models in mice (Binu, Nellikunnath Priya, Abhilash, Vineetha, & Nair, 2018; A. Hemmati et al., 2018; Wen et al., 2025) (19, 22, 29). This approach aimed to create a reliable and reproducible model of liver injury. Additionally, considering the interspecies dose conversion formula [human equivalent dose (mg/kg) = animal dose × (animal weight (kg) / human weight (kg)) 0.33] and the clinically effective dose of As₂O₃ (0.25 mg/kg/day) used in acute promyelocytic leukemia (APL) treatment, the corresponding effective dose in mice calculates to approximately 3.43 mg/kg. Due to the higher metabolic rate of mice, various experimental studies have employed higher doses to induce observable toxic effects, with commonly used doses ranging from 3 to 5 mg/kg (Ahangarpour et al., 2018; Roberts, Weimar, Vinson, Munson, & Bergeron, 2002). Therefore, our selected dose of 4 mg/kg falls within this established range, specifically chosen to reliably induce hepatic injury to evaluate protective interventions, rather than to replicate environmental exposure levels. Similarly, the doses of montelukast and ellagic acid, along with the 10-day treatment period, were determined based on previous studies that demonstrated their protective effects in chemically induced hepatotoxicity models (El-Kashef & Zaghloul, 2022; A. Hemmati et al., 2018; A. A. Hemmati et al., 2017; Zhao et al., 2021).
Stock solutions of the administered agents were prepared as follows: Montelukast was dissolved directly in normal saline (0.9% NaCl). Ellagic acid was first solubilized in a minimal volume of 0.1% NaOH solution and then diluted with normal saline to the desired concentration. For arsenic trioxide (As₂O₃), the compound was dissolved in phosphate-buffered saline (PBS, pH 7.4) with the aid of gentle vortexing and 10 minutes of sonication to achieve a clear solution.
Sample collection and biochemical analyses
After the 10-day treatment period, 24 hours after the last dose, the animals were anesthetized with an intraperitoneal injection of a combination of ketamine (70 mg/kg) and xylazine (10 mg/kg). Blood sampling was performed by cardiac puncture, and blood was collected in tubes containing EDTA. After centrifugation (3000 rpm, 15 min, 4°C), plasma was separated and stored at − 70°C. Additionally, the liver was quickly removed, and sections were fixed in 10% formalin for histopathological studies. The remaining liver tissue was stored at − 80°C for subsequent biochemical analyses. Serum biochemical parameters included the assessment of liver enzymes (ALT, AST, and ALP) as indicators of hepatocellular damage and liver function markers (albumin, total protein, and total and direct bilirubin). All measurements were performed using Pars Azmoon kits (ALT, Cat. No. 7002; AST, Cat. No. 7003; ALP, Cat. No. 7004; albumin, Cat. No. 1001; total protein, Cat. No. 1002; total and direct bilirubin, Cat. No. 1003) and an automated biochemical analyzer, following the manufacturers’ protocols.
2.3.1 Biochemical evaluations of liver tissue
After collecting liver samples, sections were used to prepare homogenates and perform biochemical tests. Total protein levels were measured using the Bradford method and determined by comparing the absorbance values with a standard curve of bovine serum albumin (Kruger, 2009). The concentration of reduced glutathione (GSH), an indicator of cellular antioxidant activity, was determined by its reaction with DTNB and measured by optical absorption at 412 nm (Ahangarpour, Alboghobeish, Oroojan, & Dehghani, 2021). Malondialdehyde (MDA) levels were assessed as a marker of lipid peroxidation using the thiobarbituric acid reaction and absorbance measurement at 532 nm (Ahangarpour et al., 2017). We determined catalase enzyme activity by measuring hydrogen peroxide decomposition and reading the absorbance of the resulting-colored complex with ammonium molybdate at 410 nm.
A
In contrast, superoxide dismutase (SOD) activity was measured using a commercial SOD Activity Assay Kit (Elabscience, Catalog No: E-BC-K020-M) according to the manufacturer's instructions, and the results were reported in units per mg of protein. We performed all measurements while considering control samples and relevant standards to ensure the accuracy of the results. Catalase activity was reported as a percentage of the control group.
2.3. Isolation and evaluation of liver mitochondria function
Liver mitochondria were isolated by the differential centrifugation method according to a standard protocol (Amiri et al., 2025). After homogenization, liver tissue was centrifuged in a buffer containing sucrose, mannitol, HEPES, EGTA, and BSA at 1500×g and 10,000×g (in two steps) to isolate mitochondria. Mitochondrial protein concentration was determined by the Bradford method. To assess mitochondrial viability, mitochondrial dehydrogenase activity, specifically succinate dehydrogenase (SDH), was measured using the MTT reduction assay. SDH activity was reported as a percentage of the control group. Mitochondrial membrane potential (ΔΨm) was measured with the fluorescent dye rhodamine 123. The decreased accumulation of this dye in mitochondria indicated membrane potential dysfunction. The production of reactive oxygen species (ROS) was determined with the fluorescent probe DCFH-DA in isolated mitochondria. The intensity of the fluorescence produced was reported as an indicator of ROS production. All steps were performed at 4°C or on ice to preserve mitochondrial function (Soleimanii et al., 2024).
2.4. Determination of inflammatory cytokine profiles in liver tissue
To extract proteins, liver tissue samples were homogenized in a lysis buffer containing protease inhibitors. After centrifugation, the supernatant was collected. The levels of proinflammatory cytokines, including TNF-α, IL-1β, and IL-6 were measured using commercial sandwich ELISA kits from Abcam (TNF-α: ab181421; IL-1β: ab214025; IL-6: ab178013; Cambridge, UK) according to the manufacturer's instructions. The ELISA method involved binding of primary antibodies to cytokines, followed by the addition of biotinylated and streptavidin-HRP-conjugated antibodies, and color development using the TMB substrate. A microplate reader measured the color intensity at 450 nm, and the cytokine concentration was calculated based on the standard curve. The results were reported as picograms per milligram of protein.
2.5. Measuring caspase-3 activity and cytochrome c release in liver tissue
Caspase-3 enzyme activity, a key marker of apoptosis in liver tissue, was measured using the Human/Mouse Cleaved Caspase-3 (Asp175) DuoSet IC ELISA Kit (R&D Systems, Cat. No. DYC835-2) according to the manufacturer’s instructions. Liver tissues were homogenized and lysed, and 100 µg of total protein from the supernatant was incubated with the caspase-3 chromogenic substrate Ac-DEVD-pNA at 37°C for 2 hours. Enzyme activity was quantified by measuring the release of p-nitroaniline (pNA) at 405 nm using a spectrophotometer. In parallel, the cytochrome c levels in liver tissue were determined using the Quantikine Mouse Cytochrome c Immunoassay Kit (R&D Systems, Cat. No. MCTC0). These assays collectively indicated apoptosis activation and mitochondrial involvement in response to liver injury, as well as the modulatory effects of protective treatments
2.6. RNA extraction, cDNA synthesis, and gene expression analysis by qRT-PCR
A
Total RNA was extracted from frozen liver tissue samples using the RNeasy Mini Kit (Qiagen, Germany) according to the manufacturer's instructions. RNA quantity and quality were assessed using a Nanodrop device and agarose gel electrophoresis. Complementary DNA (cDNA) synthesis was performed using the QuantiTect Reverse Transcription Kit (Qiagen) and oligo(dT) primers (Sigma-Aldrich, USA) according to a standard protocol. The expression of target genes was examined by real-time polymerase chain reaction (qRT-PCR) using a Rotor-Gene Q device (Qiagen) and SYBR Green I Master Mix (TaKaRa, Japan). In each 25 µL reaction, 300 ng of cDNA and 400 nM of each primer (forward and reverse) were used. The Bcl-2, Bax, and survivin genes were assayed as apoptotic targets, and the GAPDH gene was used as an internal control. Thermal conditions included an initial denaturation step at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 45 seconds. Specificity was assessed by melting curve analysis. Data were analyzed by the 2^−ΔΔCT method and normalized to GAPDH. Primers designed for target genes (bcl2, Bax, and Survivin) and the control gene (GAPDH) with a primer length of 17–24 bp, yielding amplicons of 113–196 bp as listed in Table 1. We performed all reactions in triplicate and averaged the results to ensure their accuracy
Table 1
Oligonucleotide Sequences for Interest and Reference Genes
Oligo Name
Sequence (5′ → 3′)
Amplicon, bp
GAPDH-F
AAGTTCAACGGCACAGTCAAGG
195
GAPDH-R
CATACTCAGCACCAGCATCACC
195
Bax-F
AGGGTGGCTGGGAAGGC
120
Bax-R
TGAGCGAGGCGGTGAGG
120
bcl2-F
ATCGCTCTGTGGATGACTGAGTAC
113
bcl2-R
AGAGACAGCCAGGAGAAATCAAAC
113
Survivin-F
CCCTTTCTCAAGGACCACCG
196
Survivin-R
TGTTCCTCTCTGGGGTCGTCA
196
2.7. Measurement of inflammatory markers VCAM-1, TLR4 in liver tissue
To examine inflammatory responses in liver tissue, the levels of VCAM-1 (vascular cell adhesion molecule-1) and TLR4 (Toll-like receptor 4) proteins were measured using specific ELISA kits (VCAM-1: Abcam, Cat. No. ab100750; TLR4: Novus Biologicals, Cat. No. NBP2-76570) according to the manufacturers’ instructions. Liver tissue protein homogenates were placed in wells of plates coated with the corresponding capture antibodies. After incubation and washing, detection antibodies and enzyme conjugates were added to form an antibody-antigen-antibody complex. The resulting color reaction was initiated by adding TMB substrate, and the color intensity was measured at a wavelength of 450 nm using a microplate reader. Protein concentrations were reported based on the corresponding standard curve and as picograms per milligram of total protein.
2.8. Determination of myeloperoxidase (MPO) activity in liver tissue
Myeloperoxidase (MPO) enzyme activity, a marker of neutrophil infiltration and inflammation in liver tissue, was determined using a modified calorimetric method based on the protocol of Desser et al. (1972). After homogenizing the liver tissue and centrifuging, the supernatant was collected, and the protein content of the samples was determined. Then, the samples were incubated with a substrate containing hydrogen peroxide and ortho-dianisidine. MPO activity was measured by measuring the change in optical absorbance at a wavelength of 460 nm every 30 seconds for 3 minutes with a spectrophotometer. The results were reported as enzyme activity units per mg of protein (Gabr & Alghadir, 2019).
2.9. Evaluation of DNA fragmentation (DNA Fragmentation Index, DFI) in liver tissue
To measure the level of DNA fragmentation, a valid indicator of apoptosis and DNA damage, the diphenylamine colorimetric method (DPA assay) was employed, adapted from Perandones et al. (1993). After homogenization and differential centrifugation, the samples were separated into a supernatant (containing free and fragmented DNA) and a pellet (containing intact double-stranded DNA), and DNA was extracted from both fractions. Reaction with a diphenylamine solution in an acidic medium resulted in the production of a blue color, the intensity of which was measured at a wavelength of 600 nm using a spectrophotometer. The DNA fragmentation index (DFI) was calculated and reported as the ratio of the percentage of fragmented DNA to the total DNA present (Matassov, Kagan, Leblanc, Sikorska, & Zakeri, 2004).
2.10. Histopathological studies
Following sacrifice, liver tissues were fixed in 10% buffered formalin, processed, and sectioned for hematoxylin and eosin (H&E) staining. A blinded pathologist examined the sections to assess the severity of hepatic injury, including inflammation, necrosis, and vacuolization.To provide a quantitative assessment, a semi-quantitative scoring system was used. Each histopathological feature was graded from 0 to 3: 0 (no change), 1 (mild), 2 (moderate), and 3 (severe). The total histopathological score for each sample was the sum of these individual scores, providing an objective measure of the protective effects of the treatments. Representative images were captured and included in the results
2.11. Statistical Analysis
The Kolmogorov-Smirnov test was used to examine the normality of the data distribution. Quantitative data were reported as mean ± standard error (Mean ± SEM). Comparison of means between groups was performed using one-way analysis of variance (ANOVA). If a significant difference was found, Tukey's post hoc test was used to determine differences between groups. The statistical significance level was considered less than 0.05 (P < 0.05). All analyses were performed with GraphPad Prism software version 9.5.
3. Results
3.1.
The effect of arsenic trioxide, ellagic acid, and montelukast on body weight and liver weight to body weight ratio
The results showed that administration of arsenic trioxide for 10 days caused a non-significant decrease in the body weight of the animals [F (6, 35) = 2.66, p > 0.05]. The separate consumption of ellagic acid and montelukast had no significant effect on body weight, and the weight of these groups was not statistically different from that of the control [F (6, 35) = 2.66, p > 0.05]. The combination of ellagic acid and montelukast also prevented weight loss caused by arsenic trioxide, such that body weight in these groups remained similar to the control [F (6, 35) = 2.66, p < 0.05].
On the other hand, the ratio of liver weight to body weight increased significantly in the group receiving arsenic trioxide [F (6, 35) = 3.48, p < 0.01]. Ellagic acid and montelukast alone did not significantly change this ratio [F (6, 35) = 3.48, p > 0.05]. Combining arsenic trioxide with any of these compounds individually also failed to significantly reduce the increase in the ratio [F (6, 35) = 3.48, p > 0.05]. However, the simultaneous administration of ellagic acid and montelukast, along with arsenic trioxide, significantly reduced the liver weight-to-body weight ratio and returned it to a level close to that of the control [F (6, 35) = 3.48, p < 0.05] (Table 2).
Table 2
Effect of arsenic trioxide, ellagic acid, and montelukast on body weight and liver weight to body weight ratio
Groups
Control(Normal saline)
Arsenic trioxide 4mg/kg
Ellagic Acid 30mg/kg
Montelukast 20mg/kg
Arsenic trioxide + Ellagic acid
Arsenic trioxide + Montelukast
Arsenic trioxide + Ellagic acid + Montelukast
Body weight (grams)
23.5 ± 3.4
21.5 ± 2.8
23.16 ± 3.8
23.16 ± 3.43
22.3 ± 2.8
22 ± 3.54
23.5 ± 2.4
Liver weight/body weight
3.75 ± 0.6
4.84 ± 0.92a**
3.81 ± 0.87
4.13 ± 0.85
4.25 ± 0.87
4.16V ± 0.76
3.92 ± 0.84b*
Values ​​are reported as mean ± standard error of the mean (Mean ± SEM) for each group (n = 6). Statistical symbols are as follows: a: Significant difference compared to the control group (normal saline), b: Significant difference compared to the Arsenic trioxide group, *: P < 0.05, **: P < 0.01
3.2.
The effect of ellagic acid and montelukast on serum liver enzyme changes caused by arsenic trioxide toxicity
As shown in Fig. 1, administration of arsenic trioxide (As₂O₃) for 10 days resulted in a significant increase in the levels of liver enzymes AST, ALT, and ALP in the serum of mice compared to the control group (p < 0.01), indicating cellular damage and impaired liver function. Treatment with ellagic acid (EA) or montelukast (MK) alone, along with As₂O₃, resulted in significant reductions in AST and ALT levels compared to the group receiving As₂O₃ alone (AST: F (6, 35) = 15.58, p < 0.05 and p < 0.01; ALT: F (6, 35) = 44.74, p < 0.05 and p < 0.01, for EA and MK, respectively). The simultaneous use of EA and MK had a more substantial protective effect, showing the most significant reduction in AST and ALT levels compared to the As₂O₃ group (p < 0.05).
Similarly, serum ALP levels were also significantly increased in the As₂O₃ group [F (6, 35) = 10.86, p < 0.01]. Combined EA and MK treatment significantly decreased this enzyme compared to the injured group [F (6, 35) = 10.86, p < 0.01].
Fig. 1
Effect of ellagic acid and montelukast on serum liver enzyme changes caused by arsenic trioxide toxicity. A: AST, B: ALP, C: ALT. Values are reported as mean ± standard error (Mean ± SEM) for each group (n = 6). Statistical symbols are as follows: a: indicates a significant difference compared to the control group receiving normal saline. b: Significant difference compared to the control group receiving arsenic trioxide. c: Significant difference compared to the group receiving arsenic trioxide + ellagic acid. d: Significant difference compared to the group receiving arsenic trioxide + montelukast. *: P < 0.05, **: P < 0.01
Click here to Correct
3.3.
Effects of chronic exposure to arsenic trioxide and treatment with ellagic acid and montelukast on plasma levels of total protein and albumin
Biochemical findings from the evaluation of plasma samples (Fig. 2A) showed that chronic administration of arsenic trioxide (As₂O₃) resulted in a significant decrease in total protein levels compared to the control group [F (6, 35) = 7.24, p < 0.01], indicating impaired liver function and inhibition of plasma protein synthesis. In contrast, combined treatment with ellagic acid (EA) and montelukast (MK) significantly increased total protein levels compared to the As₂O₃ group [F (6, 35) = 7.24, p < 0.05], confirming the protective effect of these compounds in maintaining hepatic protein synthesis.
In the case of albumin (Fig. 2B), As₂O₃ administration also significantly decreased plasma albumin concentration compared to the control group [F (6, 35) = 3.79, p < 0.05]. Although single or combined administration of EA and MK increased albumin levels compared to the As₂O₃ group, this increase was not statistically significant [F (6, 35) = 3.79, p > 0.05].
3.4.
The effect of ellagic acid and montelukast on changes in total and direct bilirubin caused by arsenic trioxide toxicity
The results of biochemical studies (Fig. 2C) showed that administering arsenic trioxide (As₂O₃) for 10 days significantly increased the level of total bilirubin in the serum of mice, resulting in a level more than twice that of the control group [F (6, 35) = 29.35, p < 0.01]. Ellagic acid (EA) or montelukast (MK) alone had no significant effect on total bilirubin levels. However, combined treatment with As₂O₃ and either EA or MK resulted in a significant reduction in total bilirubin compared to the As₂O₃ group [F (6, 35) = 29.35, p < 0.05], although the levels remained higher than those of the control group. It is noteworthy that the simultaneous use of EA and MK with As₂O₃ resulted in a greater reduction in total bilirubin levels, which was significant not only compared to the As₂O₃ group but also compared to the single-drug treatment groups [F (6, 35) = 29.35, p < 0.01 and p < 0.05, respectively).
On the other hand, direct bilirubin levels also increased significantly [F (6, 35) = 7.53, p < 0.01] after exposure to As₂O₃. EA and MK alone did not significantly alter this index; however, the reduction in direct bilirubin levels in the group receiving the combined treatment (As₂O₃ + EA + MK) was statistically significant compared to the As₂O₃ group [F (6, 35) = 7.53, p < 0.05] (Fig. 2D).
Fig. 2
Effect of ellagic acid and montelukast on changes in plasma levels of total protein, albumin, total and direct bilirubin caused by arsenic trioxide toxicity. A: Total protein B: Albumin C: Total bilirubin D: Direct bilirubin. Values are reported as mean ± standard error of the mean (Mean ± SEM) for each group (n = 6). Statistical symbols are as follows: a: indicates a significant difference compared to the control group receiving normal saline. b: Significant difference compared to the control group receiving arsenic trioxide. c: Significant difference compared to the group receiving arsenic trioxide + ellagic acid. d: Significant difference compared to the group receiving arsenic trioxide + montelukast. *: P < 0.05, **: P < 0.01
Click here to Correct
3.5.
The effect of arsenic trioxide, ellagic acid, and montelukast on oxidative stress indices and antioxidant status
Examination of oxidative stress indices in liver tissue showed that arsenic trioxide (As₂O₃) administration for 10 days significantly reduced catalase (CAT) enzyme activity compared to the control group [F (6, 35) = 10.68, p < 0.01; Fig. 3A]. Although separate administration of ellagic acid (EA) or montelukast (MK) together with As₂O₃ caused a relative increase in CAT activity, this increase was not statistically significant [F (6, 35) = 10.68, p > 0.05]. However, the combined treatment of As₂O₃ with both EA and MK compounds resulted in a significant improvement in CAT activity compared to the As₂O₃-receiving group [F (6, 35) = 10.68, p < 0.05], indicating a synergistic enhancing effect of these two compounds on antioxidant defense.
Superoxide dismutase (SOD) activity was also significantly reduced in response to As₂O₃ exposure [F (6, 35) = 9.75, p < 0.05; Fig. 3B]. Administration of EA or MK alone, and especially in combination, significantly increased SOD levels compared to the As₂O₃ group [F (6, 35) = 9.75, p < 0.05]. The most significant increase in SOD levels was observed in the combination treatment group. However, this increase did not reach the level of the control group, which is likely due to the remaining minor damage caused by arsenic.
The lipid peroxidation index, malondialdehyde (MDA), was significantly increased in the As₂O₃ receiving group [F (6, 35) = 20.08, p < 0.01; Fig. 3C]. Treatment with EA or MK independently, as well as in combination, significantly reduced MDA levels compared to the As₂O₃ group [F (6, 35) = 20.08, p < 0.05]. Notably, the most significant reduction in MDA levels was observed in the group receiving the combination treatment, indicating greater effectiveness of the simultaneous intervention in reducing lipid peroxidation and inhibiting oxidative stress.
The level of reduced glutathione (GSH) in the liver tissue of As₂O₃-treated animals was significantly reduced [F (6, 35) = 9.88, p < 0.01; Fig. 3D). Administration of EA and MK separately improved GSH levels [F (6, 35) = 9.88, p < 0.05], but the highest GSH recovery was observed in the combined treatment group, indicating a synergistic effect of these two compounds in enhancing cellular antioxidant capacity.
Fig. 3
Effect of arsenic trioxide, ellagic acid, and montelukast on oxidative stress indices and antioxidant status. A: Catalase activity B: SADC C: MDA D: GSH. Values are reported as mean ± standard error (Mean ± SEM) for each group (n = 6). Statistical symbols are as follows: a: Significant difference compared to the control group receiving normal saline; b: Significant difference compared to the control group receiving arsenic trioxide. c: Significant difference compared to the group receiving arsenic trioxide + ellagic acid. d: Significant difference compared to the group receiving arsenic trioxide + montelukast. *: P < 0.05, **: P < 0.01
Click here to Correct
3.6. Evaluation of the Protective Effects of Ellagic Acid and Montelukast on Arsenic Trioxide-Induced Mitochondrial Toxicity
As shown in Fig. 4A, arsenic trioxide (As₂O₃) administration resulted in a significant increase in reactive oxygen species (ROS) levels in mitochondria isolated from liver tissue compared to the control group [F (6, 35) = 151.5, p < 0.01]. Administration of ellagic acid (EA) alone reduced ROS levels compared to control [F (6, 35) = 151.5, p < 0.05]. In the As₂O₃-receiving groups, administration of EA and montelukast (MK)—either alone or in combination—significantly reduced ROS levels compared with the As₂O₃ group [F (6, 35) = 151.5, p < 0.01]. Notably, the simultaneous combination of EA and MK demonstrated a greater reduction than either compound alone [F (6, 35) = 151.5, p < 0.05].
Based on the data in Fig. 4B, exposure to As₂O₃ increased mitochondrial membrane permeability [F (6, 35) = 14.31, p < 0.01] compared to control. While EA or MK alone had no significant effect on this index, coadministration of these two compounds with As₂O₃ resulted in a significant reduction in mitochondrial membrane damage [F (6, 35) = 14.31, p < 0.05] compared to the As₂O₃ group.
The MTT assay results (Fig. 4C) also showed that As₂O₃ significantly reduced mitochondrial metabolic activity [F (6, 35) = 11.29, p < 0.01]. Administration of EA and MK—individually or in combination—was able to significantly compensate for this reduction [F (6, 35) = 11.29, p < 0.01] compared to the As₂O₃ group. In particular, the combined administration of EA and MK resulted in a greater increase in metabolic activity compared to the administration of either compound alone [F (6, 35) = 11.29, p < 0.05].
Fig. 4
Protective effects of ellagic acid and montelukast on arsenic trioxide-induced mitochondrial toxicity. A: ROS formation rate, B: Mitochondrial membrane destruction, C: Mitochondrial viability). Values are reported as mean ± standard error (Mean ± SEM) for each group (n = 6). Statistical symbols are as follows: a: Significant difference compared to the control group receiving normal saline; b: Significant difference compared to the control group receiving arsenic trioxide. c: Significant difference compared to the group receiving arsenic trioxide + ellagic acid. d: Significant difference compared to the group receiving arsenic trioxide + montelukast. *: P < 0.05, **: P < 0.01
Click here to Correct
3.7. The effect of arsenic trioxide, ellagic acid, and montelukast on inflammatory cytokines in liver tissue
The results from measuring the levels of inflammatory cytokines TNF-α, IL-1β, and IL-6 in liver tissue demonstrated that arsenic trioxide (As₂O₃) administration significantly increased these inflammatory factors compared to the control group [F (6, 35) = 81.06, p < 0.01], as shown in Fig. 5A. Concomitant treatment with ellagic acid (EA) or montelukast (MK) alone exhibited significant anti-inflammatory effects, leading to a significant reduction in IL-1β and IL-6 levels compared with the As₂O₃ group [F (6, 35) = 81.06, p < 0.05]. MK was also effective in reducing TNF-α [F (6, 35) = 159.2, p < 0.05], whereas EA alone had no significant effect on TNF-α (Fig. 5B). The simultaneous combination of EA and MK with As₂O₃ showed a synergistic effect, resulting in a significant reduction in the levels of all three cytokines (TNF-α, IL-1β, IL-6) [F (6, 35) = 81.06, p < 0.01]. This reduction was more pronounced compared to single treatments, bringing the cytokine levels closer to those of the control group (Fig. 5C).
Fig. 5
Effect of arsenic trioxide, ellagic acid, and montelukast on inflammatory cytokines in liver tissue. A: TNF-alpha B: Interleukin-6 C: Interleukin-1 beta. Values are reported as mean ± standard error (Mean ± SEM) for each group (n = 6). Statistical symbols are as follows: a: Significant difference compared to the control group receiving normal saline; b: Significant difference compared to the control group receiving arsenic trioxide. c: Significant difference compared to the group receiving arsenic trioxide + ellagic acid. d: Significant difference compared to the group receiving arsenic trioxide + montelukast. *: P < 0.05, **: P < 0.01
Click here to Correct
3.8. The effect of arsenic trioxide, ellagic acid, and montelukast on apoptosis indices in liver tissue
Administration of arsenic trioxide (As₂O₃) significantly increased caspase-3 enzyme activity and cytochrome c release from mitochondria to the cytosol in liver tissue [F (6, 35) = 29.39, p < 0.01], indicating the induction of apoptosis via the intrinsic pathway. Treatment with ellagic acid (EA) or montelukast (MK) independently significantly reduced both apoptotic indices compared to the As₂O₃ group [F (6, 35) = 29.39, p < 0.05 and p < 0.01]. These reductions were significantly more pronounced in the combined treatment group (As₂O₃ + EA + MK) and returned to levels close to the control group [F (6, 35) = 29.39, p < 0.01], as shown in Fig. 6.
Fig. 6
Effect of arsenic trioxide, ellagic acid, and montelukast on apoptosis indices in liver tissue. A: Caspase 3 activity B: Cytochrome c release. Values are reported as mean ± standard error of the mean (Mean ± SEM) for each group (n = 6). Statistical symbols are as follows: a: Significant difference compared to the control group receiving normal saline; b: Significant difference compared to the control group receiving arsenic trioxide. c: Significant difference compared to the group receiving arsenic trioxide + ellagic acid. d: Significant difference compared to the group receiving arsenic trioxide + montelukast. *: P < 0.05, **: P < 0.01
Click here to Correct
3.9.
The effect of arsenic trioxide, ellagic acid, and montelukast on the mRNA expression of Bax, Bcl-2, and Survivin genes in liver tissue
Administration of arsenic trioxide (As₂O₃) significantly increased the mRNA expression of the proapoptotic gene Bax. It significantly decreased the expression of the antiapoptotic genes Bcl-2 and Survivin in liver tissue compared to the control [F (6, 35) = 41.41, p < 0.01]. Simultaneous treatment with ellagic acid (EA) significantly corrected these changes, such that Bax expression decreased and Bcl-2 and Survivin expression significantly increased compared to the As₂O₃ alone group [F (6, 35) = 19.04, p < 0.05]. Montelukast (MK) also independently induced a decrease in Bax expression and an increase in Bcl-2 expression [F (6, 35) = 41.41, p < 0.05], but the change in Survivin expression was not significant in this group. The combined treatment of As₂O₃, EA, and MK had the most significant modulating effect, with Bax expression being significantly lower and Bcl-2 and Survivin expression being significantly higher than in the single treatment groups [F (6, 35) = 19.04, p < 0.01], approaching the level of the control group (Table 3).
Table 3
Effect of arsenic trioxide, ellagic acid, and montelukast on the mRNA expression of Bax, Bcl-2, and Survivin genes in liver tissue
Click here to download actual image
Genes
Mitochondria-
treatment
Bax mRNA
(Fold of changes)
Bcl-2 mRNA
(Fold of changes)
Bcl-2/Bax
Survivin mRNA
(Fold of changes)
Control
1 ± 0.21
1 ± 0.065
1 ± 0.31
1 ± 0.093
Arsenic trioxide 4mg/kg
4.445 ± 0.853a**
0.53 ± 0.052a**
0.118 ± 0.006a**
0.73 ± 0.044a**
Ellagic Acid 30mg/kg
1.101 ± 0.143
1.055 ± 0.297
0.971 ± 0.06
1.11 ± 0.37
Montelukast 20mg/kg
1.018 ± 0.075
1.171 ± 0.365
1.02 ± 0.22a*
1.068 ± 0.093
Arsenic trioxide 4mg/kg + Ellagic Acid 30mg/kg
3.255 ± 0.865b**
0.55 ± 0.073
0.171 ± 0.0049
0.828 ± 0.067
Arsenic trioxide 4mg/kg + Montelukast 20mg/kg
3.163 ± 0.504b**
0.65 ± 0.072
0.208 ± 0. 043
0.78 ± 0.042
Arsenic trioxide 4mg/kg + Ellagic Acid 30mg/kg + Montelukast 20mg/kg
2.59 ± 0.23b**cd*
0.73 ± 0.041b*
0.354 ± 0.012bc*
0.91 ± 0.056b*
The mRNA levels were measured, and data were normalized to GAPDH. The expression of Bax, Bcl2, and survivin in the control group was designated as 1, and the others were expressed as fold changes compared to the control. Values are expressed as mean ± SEM of 3 separate triplicate determinations (n = 8). a: Significant difference compared to the control group (normal saline) b: Significant difference compared to the Arsenic trioxide group.c: Significant difference compared to the Arsenic trioxide + Ellagic Acid group. d: Significant difference compared to the Arsenic trioxide + Montelukast group * p < 0.05 and **p < 0.01 compared to the control group.
3.10.
Effects of arsenic trioxide, ellagic acid, and montelukast on VCAM-1 and TLR4 levels in liver tissue
Arsenic trioxide (As₂O₃) administration significantly increased the expression of inflammatory proteins VCAM-1 and TLR4 in liver tissue compared to control [F (6, 35) = 31.02, p < 0.01], indicating the activation of vascular inflammatory responses and inflammatory pathways due to As₂O₃ toxicity. Treatment with ellagic acid (EA) resulted in a non-significant reduction of these increases, while montelukast (MK) significantly reduced the levels of these markers [F (6, 35) = 31.02, p < 0.01]. The most significant reduction effect was observed in the combined As₂O₃ + EA + MK group, with VCAM-1 and TLR4 levels significantly lower than in the single treatment groups [F (6, 35) = 31.02, p < 0.01] and approaching the levels of the control group (Fig. 7A and 7B).
3.11. The effect of arsenic trioxide, ellagic acid, and montelukast on MPO activity in liver tissue
Myeloperoxidase (MPO) activity, as a marker of neutrophil infiltration and inflammation severity, was significantly increased in the arsenic trioxide (As₂O₃) group [F (6, 35) = 81.32, p < 0.01], indicating the induction of an acute inflammatory response in the liver. Coadministration of ellagic acid (EA) or montelukast (MK) with As₂O₃ separately significantly reduced MPO activity compared to the As₂O₃ group [F (6, 35) = 81.32, p < 0.05], confirming the anti-inflammatory effects of these compounds. In the group receiving the combination of EA and MK along with As₂O₃, MPO activity decreased significantly more than in the other treatment groups [F (6, 35) = 81.32, p < 0.01]. It reached levels comparable to those of the control. This finding indicates the anti-inflammatory synergy of these two compounds in inhibiting neutrophil infiltration and reducing arsenic-induced liver inflammation (Fig. 7C).
3.12.
The effect of arsenic trioxide, ellagic acid, and montelukast on DNA fragmentation index (DFI) in liver tissue
Analysis of DNA Fragmentation Index (DFI) in liver tissue showed that arsenic trioxide (As₂O₃) administration significantly increased DFI [F (6, 35) = 122.3, p < 0.01], indicating severe induction of genomic damage and activation of apoptotic pathways. Co-administration of ellagic acid (EA) or montelukast (MK) with As₂O₃, separately, resulted in a significant reduction in DFI compared to the As₂O₃ group [F (6, 35) = 122.3, p < 0.01 and p < 0.05, respectively]. In the combined treatment group (As₂O₃ + EA + MK), the reduction in DFI was statistically more significant [F (6, 35) = 122.3, p < 0.01], and its levels were significantly closer to those of the control group. This finding suggests a synergistic effect of the two compounds in preventing arsenic-induced DNA damage and cellular damage in liver tissue (Fig. 7D).
Fig. 7
Effects of arsenic trioxide, ellagic acid, and montelukast on VCAM-1, MPO, DFI, and TLR4 levels in liver tissue. A: DFI, B: MPO. C: VCAM-1, D: TLR4. Values are reported as mean ± standard error (Mean ± SEM) for each group (n = 6). Statistical symbols are as follows: a: Significant difference compared to the control group receiving normal saline; b: Significant difference compared to the control group receiving arsenic trioxide. c: Significant difference compared to the group receiving arsenic trioxide + ellagic acid. d: Significant difference compared to the group receiving arsenic trioxide + montelukast. *: P < 0.05, **: P < 0.01.
Click here to Correct
3.13. Histopathological results of liver tissue after exposure to arsenic trioxide, ellagic acid, and montelukast
Exposure to arsenic trioxide resulted in significant histopathological changes in liver tissue. In this group, destruction of the typical hepatocyte structure, cell swelling, and extensive infiltration of inflammatory cells were observed, indicating severe damage and inflammation in the liver tissue. Also, disruption of sinusoidal arrangement and the presence of necrotic cells were detectable. In the groups administered ellagic acid and montelukast separately, along with arsenic, a significant improvement in the histopathological structure of the liver was observed. Cellular swelling and inflammatory cell infiltration were reduced, and the arrangement of hepatocytes returned to a more normal state. In the combination treatment group (arsenic + ellagic acid + montelukast), the histopathological improvement was more pronounced; the cellular structure was significantly preserved, and signs of inflammation and cellular damage were minimized. This group showed the lowest necrosis, indicating a synergistic protective effect of ellagic acid and montelukast in reducing arsenic-induced hepatotoxicity (Fig. 8, Table 4).
Table 4
Effects of Ellagic Acid (EA) and Montelukast (MK) on Histopathological Scores in Arsenic-Induced Hepatotoxicity.
Experimental Groups
Inflammation
Necrosis
Vacuolization
Total Score
Control
0.0 ± 0.0
0.0 ± 0.0
0.3 ± 0.6
0.3 ± 0.6
Arsenic trioxide 4mg/kg
2.7 ± 0.6a**
2.7 ± 0.6a**
2.7 ± 0.6a**
8.0 ± 1.0a**
Ellagic Acid 30mg/kg
0.0 ± 0.0
0.0 ± 0.0
0.0 ± 0.0
0.0 ± 0.0
Montelukast 20mg/kg
0.0 ± 0.0
0.0 ± 0.0
0.0 ± 0.0
0.0 ± 0.0
Arsenic trioxide 4mg/kg + Ellagic Acid 30mg/kg
1.0 ± 0.0b*
1.3 ± 0.6b*
1.7 ± 0.6
4.0 ± 1.0b**
Arsenic trioxide 4mg/kg + Montelukast 20mg/kg
1.3 ± 0.6b*
1.3 ± 0.6b*
1.7 ± 0.6
4.3 ± 1.2b**
Arsenic trioxide 4mg/kg + Ellagic Acid 30mg/kg + Montelukast 20mg/kg
0.3 ± 0.6b**
0.3 ± 0.6b**
0.7 ± 0.6b**
1.3 ± 1.2b**
Data are presented as Mean ± Standard Error (SD). (n = 6). Statistical symbols are as follows: a: Significant difference compared to the control group (normal saline), b: Significant difference compared to the Arsenic trioxide group, *: P < 0.05, **: P < 0.01. The histopathological features (inflammation, necrosis, and vacuolization) were scored from 0 (no change) to 3 (severe injury). The total score is the sum of the scores of the individual features.
Fig. 8
Histopathological results of liver tissue after exposure to arsenic trioxide, ellagic acid, and montelukast. Each group included three mice. (H&E x400). All pathology images presented in the manuscript are full and uncropped.
Click here to Correct
Fig. 9
Schematic illustration of the proposed mechanisms. Arsenic trioxide (As₂O₃) induces hepatotoxicity via oxidative stress, inflammatory responses, and mitochondrial apoptosis. Ellagic Acid (EA) and Montelukast (MK) mitigate this damage by modulating these pathways, with their combination demonstrating synergistic protective effects against As₂O₃-induced liver injury.
Click here to Correct
4. Discussion
This study comprehensively investigated the pathogenesis of arsenic trioxide (As₂O₃)-induced liver injury in an animal model. It evaluated the protective effects of ellagic acid (EA) and montelukast (MK), individually and in combination. As₂O₃ exposure led to extensive disturbances in liver structure and function, including significant increases in AST, ALT, and ALP enzymes, total and direct bilirubin, and severe histopathological damage such as cellular swelling, inflammatory cell infiltration, and hepatocyte degeneration. These changes indicated parenchymal damage and impaired biliary excretion. Consistent increases in the lipid peroxidation index (MDA) and decreases in endogenous antioxidants (GSH, SOD, and CAT) highlighted severe oxidative stress in liver tissue. Furthermore, mitochondrial functional impairment, characterized by decreased SDH enzyme activity, increased mitochondrial ROS, and increased mitochondrial membrane permeability (MPTP), confirmed energy metabolism disruption. This was accompanied by molecular outcomes such as increased caspase-3 activity and cytochrome c release (markers of intrinsic apoptosis pathway activation) (Fig. 9).
Arsenic-induced hepatotoxicity also triggered severe inflammatory responses by activating the TLR4 inflammatory axis, increasing VCAM-1 expression, and elevating MPO activity. Apoptosis-related gene expression was affected, with increased Bax and decreased Bcl-2 and Survivin, indicating the induction of programmed cell death via the mitochondrial endogenous pathway. The DFI index, a proxy for DNA damage and fragmentation, increased significantly in the arsenic-treated group. While individual administration of EA and MK modulated some disorders, combination treatment was significantly more effective, simultaneously inhibiting inflammation, apoptosis, and genomic damage. These data confirm the strong synergistic role of the two compounds in maintaining liver cell structure and function, indicating their multifaceted effects at biochemical, molecular, and tissue levels.
Macroscopically, As₂O₃ administration, despite a slight and insignificant decrease in animal body weight, significantly increased the liver-to-body weight ratio. Hepatomegaly, commonly observed with hepatotoxicants, reflects cellular edema, inflammatory cell infiltration, and degenerative changes in the liver parenchyma, characteristic of severe liver injury (Rusyn et al., 2021). The combined administration of EA and MK prevented arsenic-induced weight loss, indicating an overall improvement in health. In the combination therapy group, the liver weight-to-body weight ratio decreased significantly to values comparable to those of the control group. This restoration of morphological homeostasis highlights EA's antioxidant and anti-inflammatory effects (Ashoush, Saeed, & Soliman, 2024) and MK's ability, as a leukotriene receptor antagonist (Alnfakh et al., 2022), to reduce edema and inflammatory cell infiltration, thereby restoring liver structure and function. This finding strongly supports combination therapy.
Comprehensive serum biochemical analysis revealed significant increases in AST, ALT, and ALP levels in the As₂O₃-exposed group. These enzymes, sensitive biomarkers of liver cell injury, are released from damaged hepatocytes into the bloodstream, indicating disruption of cell membrane integrity and parenchymal necrosis (Tamber, Bansal, Sharma, Singh, & Sharma, 2023). This damage is primarily associated with excessive ROS production by arsenic metabolites and widespread lipid peroxidation (Bibha, Akhigbe, Hamed, & Akhigbe, 2024; Tamber et al., 2023). Previous studies have also confirmed a strong correlation between arsenic exposure and increased enzyme levels, which is rooted in oxidative stress, mitochondrial dysfunction, and the activation of an inflammatory cascade (Cantoni, Zito, Guidarelli, Fiorani, & Ghezzi, 2022; Prakash, Chhikara, & Kumar, 2022). Co-administration of EA significantly reduced AST and ALT levels, attributed to its strong antioxidant capacity, which neutralizes free radicals, reduces lipid peroxidation, and maintains cell membrane integrity (Naraki, Rahbardar, Ajiboye, & Hosseinzadeh, 2023). EA's ability to modulate inflammatory signaling pathways further alleviates liver injury and inhibits enzyme leakage (Aishwarya, Solaipriya, & Sivaramakrishnan, 2021). Similarly, MK significantly reduced AST and ALT levels. As a selective antagonist of cysteinyl-leukotriene 1 receptors (CysLT1Rs), MK reduces inflammation by inhibiting leukotrienes, pivotal mediators in the pathogenesis of liver damage (Abdelrahman, Abdelaziz, & Abdelmageed, 2025). Increasing evidence also highlights MK's antioxidant properties (Soltanieh, Avizeh, Najafzadeh Varzi, Razi Jalali, & Ghorbanpour, 2021). The most significant reduction in AST, ALT, and ALP levels occurred in the combination treatment group, demonstrating the superiority of combining EA's antioxidant mechanisms with MK's anti-inflammatory effects for stronger hepatocellular protection against arsenic-induced oxidative and inflammatory damage.
The significant increase in total and direct bilirubin in the serum of As₂O₃-exposed animals reflects severe impairment in the liver's metabolic and excretory function, as well as cholestasis due to arsenic toxicity (Hernández-Zavala et al., 1998). Arsenic disrupts bilirubin absorption, conjugation, and excretion by damaging hepatocytes and bile duct cells (Roggenbeck, 2016). Inflammation and bile duct damage further contribute. Co-administration of EA significantly reduced total bilirubin levels, likely due to its antioxidant and anti-inflammatory properties, which protect hepatocytes and bilirubin transport systems, and improve bile flow (Wojtunik-Kulesza et al., 2025). MK also significantly reduced total bilirubin levels, possibly due to reduced liver inflammation and improved liver cell function. MK's association with oxidative stress reduction is also significant in improving bilirubin metabolism (Kuru et al., 2015). The most significant reduction in total and direct bilirubin levels was observed in the combination treatment group, indicating a strong synergistic effect. By simultaneously targeting oxidative stress and inflammation, this combination comprehensively counters multiple mechanisms of arsenic-induced liver injury, preserving hepatocyte integrity and enhancing bilirubin transport pump function.
As₂O₃ exposure resulted in a significant decrease in total plasma protein and plasma albumin levels, indicating impaired liver biosynthetic function. Arsenic damages hepatocytes by inducing oxidative stress, mitochondrial dysfunction, and activating apoptotic pathways, thereby reducing protein synthesis (Prakash et al., 2022). Systemic inflammation can also contribute. This reduction is attributed to cell necrosis, reduced cellular energy, and mitochondrial dysfunction, as ATP-dependent protein synthesis is compromised by damaged mitochondria (Yen et al., 2012). Co-administration of EA and MK significantly increased total plasma protein levels, indicating their protective effect on protein synthesis. The combination of these two mechanisms (reducing oxidative stress and inhibiting inflammation) can effectively protect the liver's protein synthesis machinery. Although plasma albumin levels did not increase significantly in the treatment groups, a trend of improvement was observed, possibly due to albumin's longer half-life or the need for higher doses and longer treatment duration (Caraceni, Tufoni, & Bonavita, 2013). These findings emphasize the importance of combined approaches in protecting the liver's synthetic function from toxin-induced damage.
Oxidative stress and weakened antioxidant defense mechanisms play crucial roles in the pathogenesis of liver damage (Conde et al., 2022). As₂O₃ administration significantly reduced endogenous antioxidant enzyme activities (catalase and SOD), decreased reduced glutathione (GSH) levels, and significantly increased malondialdehyde (MDA) levels in liver tissue, indicating severe oxidative stress and weakened endogenous defense. Arsenic damages cellular components, especially membrane lipids, by producing free radicals and ROS (Ganie et al., 2024). Increased MDA indicates extensive cell membrane damage, while decreased GSH and antioxidant enzyme activity reduce the liver's ability to neutralize free radicals (Chandimali et al., 2025). EA administration, combined with arsenic trioxide, significantly improved SOD, MDA, and GSH levels. EA, with its high antioxidant capacity, neutralizes free radicals, reduces lipid peroxidation, and enhances the activity of antioxidant enzymes. This compound also activates key antioxidant signaling pathways, such as the Nrf2 pathway, leading to increased expression of phase II antioxidant enzymes (Aslan et al., 2021). MK administration also significantly improved SOD, MDA, and GSH levels. In addition to its anti-inflammatory properties, MK exhibits antioxidant effects that help reduce ROS production and modulate the activity of antioxidant enzymes. MK-induced inflammation reduction indirectly reduces ROS production, breaking the vicious cycle of inflammation-oxidation (Chen et al., 2022). The combination group showed the most significant increase in SOD and GSH and the lowest MDA levels, indicating a strong synergistic effect against oxidative stress. This comprehensive approach robustly defends against arsenic-induced oxidative and inflammatory damage, restoring redox balance.
From a cellular function perspective, mitochondria are vital for energy production (ATP) and cellular homeostasis; their dysfunction is a significant marker of cell damage and death (Casanova, Wevers, Navarro-Ledesma, & Pruimboom, 2023). As₂O₃ exposure significantly increased mitochondrial ROS production, increased mitochondrial membrane permeability (MPTP), and decreased mitochondrial metabolic activity (MTT). These findings confirm that mitochondria are a significant and vulnerable target in arsenic-induced toxicity (Prakash et al., 2022). By disrupting mitochondrial electron transport chain complexes and inhibiting intracellular antioxidant enzymes, As₂O₃ significantly increases ROS production and reduces its neutralization capacity, damaging mitochondrial DNA, proteins, and lipids (Negi, Singh, Singh, Pandey, & Kumar, 2024). EA administration significantly reduced mitochondrial ROS production and restored mitochondrial metabolic activity. EA helps improve mitochondrial function and prevent disruptions in ATP production by neutralizing free radicals, maintaining mitochondrial membrane integrity, and enhancing mitochondrial antioxidant enzymes (Li et al., 2022). Previous studies also showed that EA prevents mPTP opening and MK prevents cytochrome c release by stabilizing the mitochondrial membrane (Ardah, Bharathan, Kitada, & Haque, 2020). MK also reduced ROS production and restored mitochondrial metabolic activity. While primarily known as an anti-inflammatory agent, increasing evidence suggests that MK has antioxidant and mitochondrial protective properties, potentially achieved by inhibiting inflammatory pathways associated with mitochondrial dysfunction (Mansour et al., 2018). The combination group exhibited the most significant synergistic effect, resulting in a further reduction in ROS levels and a substantial improvement in mitochondrial membrane damage. This represents a comprehensive approach to counteract arsenic-induced mitochondrial toxicity, addressing both mitochondrial ROS production and the maintenance of this vital organelle's structure and function.
A key finding is the inhibitory effect of combined EA and MK on the primary mechanisms of As₂O₃-induced liver injury. As₂O₃ administration led to clear activation of inflammatory pathways, evidenced by increased VCAM-1 and TLR4 expression in liver tissue. These inflammatory axes play a crucial role in the progression of tissue damage by stimulating the innate immune response and facilitating the infiltration of inflammatory cells (Singh, Kaur, Kumari, Pasricha, & Singh, 2023). The TLR4/MyD88/NF-κB pathway is a key regulator of toxin-induced inflammation, and its activation leads to increased production of cytokines such as TNF-α, IL-1β, and IL-6 (J. Zhang et al., 2020). These changes are indicative of inflammation, impaired mitochondrial function, induction of apoptosis, and disruption of cellular homeostasis.
Treatment with the combination of EA and MK significantly inhibited these inflammatory processes. The reduced levels of TNF-α, IL-1β, and IL-6 in this combination group indicated a synergistic effect in controlling the hyperactivated immune response. The anti-inflammatory mechanisms are well understood: EA reduces inflammatory factor expression by inhibiting IκBα phosphorylation and preventing NF-κB translocation to the nucleus (Alfaris et al., 2021). In contrast, MK inhibits cysteinyl leukotriene receptors (CysLT1R) and TLR4 signaling (Seetharaman, Owens, & Gangaraju, 2024). Previous studies show that combining polyphenolic agents with leukotriene antagonists can produce potent anti-inflammatory effects in various models of tissue injury (Yoon & Baek, 2005).
Indices related to neutrophil infiltration and DNA damage were also affected by As₂O₃. Myeloperoxidase (MPO) activity (neutrophil infiltration index) (Lin, Chen, Chen, & Guo, 2024) and DNA fragmentation index (DFI) (apoptosis index) (H. Zhang et al., 2023) were significantly increased in the As₂O₃ group. The combination of EA and MK synergistically reduced these two indices. EA inhibited lipid peroxidation and ROS, while MK inhibited neutrophil infiltration and oxidative DNA damage by inhibiting inflammatory enzymes. The significant reduction in DFI in the combination treatment group indicates protection of the liver cell genome against ROS-induced damage and apoptotic pathways.
Molecular findings also confirmed these protective effects. As₂O₃ administration increased Bax expression (pro-apoptotic gene) and decreased Bcl-2 and Survivin expression (anti-apoptotic genes) (Sanaei & Kavoosi, 2021). While EA or MK independently resulted in partial modulation, combined treatment led to a significant increase in anti-apoptotic gene expression and a substantial decrease in Bax protein levels. These effects are attributed to EA's activation of the Nrf2/ARE pathway (Wang, Botchway, Zhang, & Liu, 2022) and MK's inhibition of p53-dependent pathways (Tong et al., 2019). This genetic balance plays a key role in preventing cell death and maintaining liver cell function.
Histopathological findings directly confirmed and complemented the observed biochemical and functional changes, providing a morphological picture of the damage at the tissue level. Arsenic trioxide exposure resulted in significant histopathological changes in liver tissue, including destruction of hepatocyte lamellar structure, cell swelling due to impaired osmoregulation, extensive inflammatory cell infiltration (lymphocytes and macrophages) in the portal and intralobular spaces, and focal necrosis and apoptosis (Biram, Hussein, & Salem, 2023). These changes indicate severe liver damage and inflammatory response activation. EA administration showed significant improvement in liver histopathological structure. Cellular swelling and inflammatory cell infiltration were significantly reduced, and hepatocyte arrangement and sinusoid structure returned to a more normal state. MK also produced significant improvement in liver histopathology, with reduced cellular swelling and inflammatory cell infiltration, and restored hepatocyte arrangement. In the combination treatment group, histopathological improvement was more pronounced, with a preserved cellular structure and reduced inflammation and cellular damage. This group showed the lowest levels of necrosis. This strong synergistic effect, combining EA's antioxidant mechanisms with MK's anti-inflammatory effects, provides a comprehensive approach to protect the liver against arsenic toxicity. These histopathological observations reinforce the validity of the biochemical and molecular findings, providing strong evidence of the compounds' hepatoprotective effects.
It is important to note that our study was conducted in healthy mice, which is a standard model for elucidating the fundamental mechanisms of drug-induced hepatotoxicity. The pathophysiology in patients with APL may be more complex due to the underlying disease and concomitant medications. Therefore, while our findings provide strong mechanistic evidence for the hepatoprotective effects of EA and MK, their efficacy and safety must be further validated in disease-specific models or clinical settings.
Overall, the combination of EA and MK demonstrated remarkable, multifaceted effects, reducing inflammatory markers, improving mitochondrial function, reducing apoptosis, and providing genomic protection. These multi-mechanistic effects, including the inhibition of TLR4/ VCAM-1 inflammatory pathways, reduction of neutrophil infiltration, preservation of mitochondrial structure, and restoration of the balance between pro- and anti-apoptotic genes, make the combination of EA and MK a practical option for reducing arsenic-induced hepatotoxicity. Given its high efficacy in this experimental model, future studies should investigate its safety, optimal dosage, and clinical transferability in patients at high risk of As₂O₃ hepatotoxicity.
5. Conclusion
The present study demonstrates that arsenic trioxide (As₂O₃) induces severe hepatic structural and functional damage, primarily through oxidative stress, activation of inflammatory pathways, and disruption of mitochondrial integrity. Our findings reveal that ellagic acid (EA) and montelukast (MK), particularly in combination, offer significant therapeutic potential in mitigating As₂O₃-induced hepatotoxicity. This combination effectively reduced liver injury markers, reversed oxidative stress, and restored mitochondrial function. Crucially, it prevented programmed cell death by modulating key apoptotic genes and inhibiting caspase-3 activity, while also reducing DNA fragmentation. Furthermore, the combined treatment powerfully suppressed As₂O₃-activated inflammatory pathways, as evidenced by the inhibition of the TLR4 axis, a reduction in VCAM-1 and MPO levels, and a significant decrease in pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6), alongside limiting neutrophil infiltration. This multifaceted action of combination therapy highlights its comprehensive efficacy in combating arsenic-induced liver inflammation and injury.
Overall, our findings strongly support the high potential of the EA and MK combination as a novel complementary therapeutic approach to reduce the hepatic side effects of As₂O₃. Such an approach could be a pivotal step towards optimizing anticancer treatments by enhancing drug tolerability, minimizing treatment discontinuation risks, improving chemotherapy effectiveness, and ultimately elevating patients' quality of life. We recommend that future studies focus on determining optimal doses, evaluating safety in human models, and developing targeted formulations for the simultaneous drug delivery of these compounds to facilitate clinical translation.
6. Clinical trial number
Not applicable
Conflict of Interest
There is nothing to declare.
A
Acknowledgement
AcknowledgmentsThis paper was financially supported by the Vice Chancellor of Research, Dezful University of Medical Sciences, Dezful, Iran (MED-402075-1402). Funding sources are not involved in the study design, data collection, analysis, interpretation, manuscript writing, or the decision to submit the manuscript for publication.
A
Funding
This research was financially supported by the Vice Chancellor of Research, Dezful University of Medical Sciences, Dezful, Islamic Republic of Iran (Grant No. MED-402075-1402). The funding body had no role in the study design, data collection, analysis, interpretation, manuscript preparation, or the decision to submit the article for publication
A
Author Contribution
Author Contributions StatementMaryam Gharibi: Investigation, Methodology, Formal analysis, Writing – Original Draft.Ali Akbar Oroojan: Conceptualization, Supervision, Project administration, Writing – Review & Editing.Mohammad Amin Behmanesh: Histological analysis, Methodology, Validation.Neda Amirgholami: Biochemical assays, Data curation, Visualization.Hooman Etedali: Animal handling, Sample collection, Resources.Soheila Alboghobeish: Conceptualization, Supervision, Funding acquisition, Writing – Review & Editing, Corresponding author.All authors reviewed and approved the final manuscript.Declaration:We hereby declare that all authors have contributed substantially to the study, have read and approved the final manuscript, and agree to be accountable for all aspects of the work.
7. References
Abdelrahman RS, Abdelaziz RR, Abdelmageed ME (2025) Montelukast alleviates thioacetamide-induced hepatic encephalopathy in rats. Naunyn Schmiedebergs Arch Pharmacol, 1–12
Ahangarpour A, Alboghobeish S, Oroojan AA, Dehghani MA (2021) Caffeic acid protects mice pancreatic islets from oxidative stress induced by multi-walled carbon nanotubes (MWCNTs). Paper presented at the Veterinary Research Forum
Ahangarpour A, Alboghobeish S, Rezaei M, Khodayar MJ, Oroojan AA, Zainvand M (2018) Evaluation of diabetogenic mechanism of high fat diet in combination with Arsenic exposure in male mice. Iran J Pharm Research: IJPR 17(1):164
Ahangarpour A, Oroojan AA, Rezaei M, Khodayar MJ, Alboghobeish S, Zeinvand M (2017) Effects of butyric acid and arsenic on isolated liver mitochondria and pancreatic islets of male mouse. Gastroenterol Hepatol bed bench 10(1):44–53
Aishwarya V, Solaipriya S, Sivaramakrishnan V (2021) Role of ellagic acid for the prevention and treatment of liver diseases. Phytother Res 35(6):2925–2944
Al-Allaf LIK (2023) Montelukast: A Review of Articles on the Experimental Level. Annals of the College of Medicine Mosul, 45(2), 227.220-236.220
Alfaris N, Alshammari G, Altamimi J, Aljabryn D, Alagal R, Aldera H, Yahya M (2021) Ellagic acid prevents streptozotocin-induced hippocampal damage and memory loss in rats by stimulating Nrf2 and nuclear factor-κB, and activating insulin receptor substrate/PI3K/Akt axis. J Physiol Pharmacol, 72(4)
Alnfakh ZA, Al-Mudhafar DH, Al-Nafakh RT, Jasim AE, Hadi NR (2022) The anti-inflammatory and antioxidant effects of Montelukast on lung sepsis in adult mice. J Med Life 15(6):819
Amiri R, Fallah F, Ghorbanzadeh B, Oroojan AA, Behmanesh MA, Alboghobeish S (2025) Mitigating morphine dependence and withdrawal: The role of venlafaxine and calcium channel blockers in mitochondrial damage and oxidative stress in the brain. Brain Res Bull, 111364
Ardah MT, Bharathan G, Kitada T, Haque ME (2020) Ellagic acid prevents dopamine neuron degeneration from oxidative stress and neuroinflammation in MPTP model of Parkinson’s disease. Biomolecules 10(11):1519
Ashoush S, Saeed Z, Soliman E (2024) Antioxidant and anti-inflammatory effects of ellagic acid as a new therapy for Trichinella spiralis infection. J Helminthol 98:e78
Aslan A, Beyaz S, Gok O, Can MI, Erman F, Erman O (2021) The impact of ellagic acid on some apoptotic gene expressions: a new perspective for the regulation of pancreatic Nrf-2/NF-κB and Akt/VEGF signaling in CCl4-induced pancreas damage in rats. Immunopharmacol Immunotoxicol 43(2):145–152
AU WY, KWONG YL (2008) Arsenic trioxide: safety issues and their management 1. Acta Pharmacol Sin 29(3):296–304
Bibha K, Akhigbe T, Hamed M, Akhigbe R (2024) Metabolic derangement by arsenic: a review of the mechanisms. Biol Trace Elem Res 202(5):1972–1982
Binu P, Nellikunnath Priya M, Abhilash S, Vineetha RC, Nair H (2018) Protective effects of eugenol against hepatotoxicity induced by arsenic trioxide: An antileukemic drug. Iran J Med Sci 43(3):305
Biram D, Hussein Y, Salem RR (2023) Toxic Effect of Subchronic Use of Arsenic on the Liver of Adult Male Albino Rats and the Ameliorating Effect of Cerium Oxide Nanoparticles: Biochemical and Histological Study. Egypt J Histol 46(2):743–753
Borah P, Kumar M, Devi P (2020) Types of inorganic pollutants: metals/metalloids, acids, and organic forms. Inorganic pollutants in water. Elsevier, pp 17–31
Butola LK, Dhok A, Ambad R, Kanyal D, Jha RK (2021) Leukotrienes and inflammation–A review. Indian J Forensic Med Toxicol 15(2):295–301
Cantoni O, Zito E, Guidarelli A, Fiorani M, Ghezzi P (2022) Mitochondrial ROS, ER stress, and Nrf2 crosstalk in the regulation of mitochondrial apoptosis induced by arsenite. Antioxidants 11(5):1034
Caraceni P, Tufoni M, Bonavita ME (2013) Clinical use of albumin. Blood Transfus 11(Suppl 4):s18
Casanova A, Wevers A, Navarro-Ledesma S, Pruimboom L (2023) Mitochondria: It is all about energy. Front Physiol 14:1114231
Chandimali N, Bak SG, Park EH, Lim H-J, Won Y-S, Kim E-K, Lee SJ (2025) Free radicals and their impact on health and antioxidant defenses: A review. Cell death discovery 11(1):19
Chen H-C, Chiou H-YC, Tsai M-L, Chen S-C, Lin M-H, Chuang T-C, Kuo C-H (2022) Effects of montelukast on arsenic-induced epithelial-mesenchymal transition and the role of reactive oxygen species production in human bronchial epithelial cells. Front Pharmacol 13:877125
de la Conde L, Goicoechea L, Torres S, Garcia-Ruiz C, Fernandez-Checa JC (2022) Role of oxidative stress in liver disorders. Livers 2(4):283–314
Dias MC, Pinto DC, Silva AM (2021) Plant flavonoids: Chemical characteristics and biological activity. Molecules 26(17):5377
Douer D, Hu W, Giralt S, Lill M, DiPersio J (2003) Arsenic trioxide (Trisenox®) therapy for acute promyelocytic leukemia in the setting of hematopoietic stem cell transplantation. Oncologist 8(2):132–140
El-Kashef DH, Zaghloul RA (2022) Ameliorative effect of montelukast against carbon tetrachloride-induced hepatotoxicity: Targeting NLRP3 inflammasome pathway. Life Sci 304:120707
Gabr SA, Alghadir AH (2019) Research Article Evaluation of the Biological Effects of Lyophilized Hydrophilic Extract of Rhus coriaria on Myeloperoxidase (MPO) Activity, Wound Healing, and Microbial Infections of Skin Wound Tissues
Ganie SY, Javaid D, Hajam YA, Reshi MS (2024) Arsenic toxicity: sources, pathophysiology and mechanism. Toxicol Res 13(1):tfad111
Hemmati A, Olapour S, Varzi HN, Khodayar M, Dianat M, Mohammadian B, Yaghooti H (2018) Ellagic acid protects against arsenic trioxide–induced cardiotoxicity in rat. Hum Exp Toxicol 37(4):412–419
Hemmati AA, Olapour S, Najafzadeh Varzi H, Khodayar MJ, Dianat M, Mohammadian B, Yaghooti H (2017) The evaluation of the ameliorative effect of montelukast against arsenic trioxide-induced cardiotoxicity in rats. J Nat Pharm Prod, 12(4), e65046
Hernández-Zavala A, Razo D, Aguilar LM, Garcıa-Vargas C, Borja GG, V. H., Cebrián ME (1998) Alteration in bilirubin excretion in individuals chronically exposed to arsenic in Mexico. Toxicol Lett 99(2):79–84
Iqbal MJ, Kabeer A, Abbas Z, Siddiqui HA, Calina D, Sharifi-Rad J, Cho WC (2024) Interplay of oxidative stress, cellular communication and signaling pathways in cancer. Cell Communication Signal 22(1):7
Jiang H, Liu L, Zheng T, Yin D (2011) An Evidence-Based Perspective of Arsenic Trioxide (As2O3) for Cancer Patients. Evidence-based Anticancer Materia Medica. Springer, pp 37–64
Kruger NJ (2009) The Bradford method for protein quantitation. protein protocols Handb, 17–24
Kuru S, Kismet K, Barlas AM, Tuncal S, Celepli P, Surer H, Ertas E (2015) The effect of montelukast on liver damage in an experimental obstructive jaundice model. Visc Med 31(2):131–138
Li H, Chen X, Huang Z, Chen D, Yu B, Luo Y, Chen H (2022) Ellagic acid enhances muscle endurance by affecting the muscle fiber type, mitochondrial biogenesis and function. Food Funct 13(3):1506–1518
Lin W, Chen H, Chen X, Guo C (2024) The roles of neutrophil-derived myeloperoxidase (MPO) in diseases: the new progress. Antioxidants 13(1):132
List A, Beran M, DiPersio J, Slack J, Vey N, Rosenfeld C, Greenberg P (2003) Opportunities for Trisenox®(arsenic trioxide) in the treatment of myelodysplastic syndromes. Leukemia 17(8):1499–1507
Liu M, Zheng B, Liu P, Zhang J, Chu X, Dong C, Liu Y (2021) Exploration of the hepatoprotective effect and mechanism of magnesium isoglycyrrhizinate in mice with arsenic trioxide-induced acute liver injury. Mol Med Rep 23(6):438
Lodder CM (2011) Investigation of the neutrophil-directed anti-inflammatory properties of the cysteinyl leukotriene receptor antagonist, montelukast. University of Pretoria
Mansour RM, Ahmed MA, El-Sahar AE, Sayed E, N. S (2018) Montelukast attenuates rotenone-induced microglial activation/p38 MAPK expression in rats: Possible role of its antioxidant, anti-inflammatory and antiapoptotic effects. Toxicol Appl Pharmcol 358:76–85
Matassov D, Kagan T, Leblanc J, Sikorska M, Zakeri Z (2004) Measurement of apoptosis by DNA fragmentation. Apoptosis Methods and Protocols. Springer, pp 1–17
Naraki K, Rahbardar MG, Ajiboye BO, Hosseinzadeh H (2023) The effect of ellagic acid on the metabolic syndrome: A review article. Heliyon, 9(11)
Negi V, Singh P, Singh L, Pandey RK, Kumar S (2024) A comprehensive review on molecular mechanism involved in arsenic trioxide mediated cerebral neurodegenerative and infectious diseases. Infect Disorders-Drug TargetsDisorders) 24(3):51–59
Prakash C, Chhikara S, Kumar V (2022) Mitochondrial dysfunction in arsenic-induced hepatotoxicity: pathogenic and therapeutic implications. Biol Trace Elem Res 200(1):261–270
Pu S, Liu Q, Li Y, Li R, Wu T, Zhang Z, He J (2019) Montelukast prevents mice against acetaminophen-induced liver injury. Front Pharmacol 10:1070
Roberts SM, Weimar WR, Vinson J, Munson JW, Bergeron RJ (2002) Measurement of arsenic bioavailability in soil using a primate model. Toxicol Sci 67(2):303–310
Roggenbeck BA (2016) Hepatobiliary Transport of Arsenic
Rusyn I, Arzuaga X, Cattley RC, Corton JC, Ferguson SS, Godoy P, Roberts RA (2021) Key characteristics of human hepatotoxicants as a basis for identification and characterization of the causes of liver toxicity. Hepatology 74(6):3486–3496
Sanaei M, Kavoosi F (2021) Effect of valproic acid on the class I histone deacetylase 1, 2 and 3, tumor suppressor genes p21WAF1/CIP1 and p53, and intrinsic mitochondrial apoptotic pathway, pro-(Bax, Bak, and Bim) and anti-(Bcl-2, Bcl-xL, and Mcl-1) apoptotic genes expression, cell viability, and apoptosis induction in hepatocellular carcinoma HepG2 cell line. Asian Pac J Cancer Prev 22(S1):89–95
Seetharaman AT, Owens CE, Gangaraju R (2024) Cysteinyl Leukotriene Receptor Antagonism by Montelukast to Treat Visual Deficits. J Ocul Pharmacol Ther 40(10):617–628
Senavirathna T, Shafaei A, Lareu R, Balmer L (2024) Unlocking the therapeutic potential of ellagic acid for non-alcoholic fatty liver disease and non-alcoholic steatohepatitis. Antioxidants 13(4):485
Shiek SS, Sajai ST, Dsouza HS (2023) Arsenic-induced toxicity and the ameliorative role of antioxidants and natural compounds. J Biochem Mol Toxicol, 37(3), e23281
Singh V, Kaur R, Kumari P, Pasricha C, Singh R (2023) ICAM-1 and VCAM-1: Gatekeepers in various inflammatory and cardiovascular disorders. Clin Chim Acta 548:117487
Soleimanii A, Fallah F, Ghorbanzadeh B, Oroojan AA, Amirgholami N, Alboghobeish S (2024) Simultaneous use of venlafaxine and calcium channel blockers on tolerance to morphine: The role of mitochondrial damage and oxidative stress in the brain. Pharmacol Biochem Behav 245:173864
Soltanieh A, Avizeh R, Najafzadeh Varzi H, Razi Jalali M, Ghorbanpour M (2021) Antioxidant Effect of Montelukast on Acute Lung Injury Induced by Lipopolysaccharide in Dogs. J Babol Univ Med Sci 23(1):229–235
Tamber SS, Bansal P, Sharma S, Singh RB, Sharma R (2023) Biomarkers of liver diseases. Mol Biol Rep 50(9):7815–7823
Tong J, Yu Q, Xu W, Yu W, Wu C, Wu Y, Yan H (2019) Montelukast enhances cytocidal effects of carfilzomib in multiple myeloma by inhibiting mTOR pathway. Cancer Biol Ther 20(3):381–390
Wang Q, Botchway BO, Zhang Y, Liu X (2022) Ellagic acid activates the Keap1-Nrf2-ARE signaling pathway in improving Parkinson’s disease: A review. Biomed Pharmacother 156:113848
Wen J, Li A, Wang Z, Guo X, Zhang G, Litzow MR, Liu Q (2025) Hepatotoxicity induced by arsenic trioxide: clinical features, mechanisms, preventive and potential therapeutic strategies. Front Pharmacol 16:1536388
Wojtunik-Kulesza K, Niziński P, Krajewska A, Oniszczuk T, Combrzyński M, Oniszczuk A (2025) Therapeutic Potential of Ellagic Acid in Liver Diseases. Molecules 30(12):2596
Yang Y, Li Y, Li R, Wang Z (2024) Research progress on arsenic, arsenic-containing medicinal materials, and arsenic-containing preparations: clinical application, pharmacological effects, and toxicity. Front Pharmacol 15:1338725
Yen Y-P, Tsai K-S, Chen Y-W, Huang C-F, Yang R-S, Liu S-H (2012) Arsenic induces apoptosis in myoblasts through a reactive oxygen species-induced endoplasmic reticulum stress and mitochondrial dysfunction pathway. Arch Toxicol 86(6):923–933
Yoon J-H, Baek SJ (2005) Molecular targets of dietary polyphenols with anti-inflammatory properties. Yonsei Med J 46(5):585
Zeb A (2018) Ellagic acid in suppressing in vivo and in vitro oxidative stresses. Mol Cell Biochem 448(1):27–41
Zhang H, Zhu F-Y, He X-J, Tang S-H, Long T, Peng L, Zhang X-P (2023) The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology. Open Life Sci 18(1):20220597
Zhang J, Mi Y, Zhou R, Liu Z, Huang B, Guo R, Quan S (2020) The TLR4-MyD88-NF-κB pathway is involved in sIgA-mediated IgA nephropathy. J Nephrol 33(6):1251–1261
Zhao L, Mehmood A, Soliman MM, Iftikhar A, Iftikhar M, Aboelenin SM, Wang C (2021) Protective effects of ellagic acid against alcoholic liver disease in mice. Front Nutr 8:744520
Total words in MS: 9342
Total words in Title: 18
Total words in Abstract: 251
Total Keyword count: 6
Total Images in MS: 9
Total Tables in MS: 4
Total Reference count: 69