Deficiency of Interleukin-40 Prevents Intestinal Damage in Experimental Necrotizing Enterocolitis by Inhibiting NETosis

YunfeiZhang1

CuilianYe2

Xinzhong1

XionghuiDing3

YihangYang1

YueMa1

ChunbaoGuo

M.D., Ph.D.

1,4✉Emailguochunbao@foxmail.comEmailguochunbao@hospital.cqmu.edu.cn

1Department of PediatricsChongqing Health Center for Women and ChildrenChongqingChina

2School of Pharmacy and BioengineeringChongqing University of Technology400054ChongqingP.R. China

3Department of BurnChildren’s Hospital of Chongqing Medical UniversityChongqingChina

Department of pediatrics, Department of pediatricsChildren’s Hospital of Chongqing Medical University, Chongqing Health Center for Women and Children, Women and Children’s Hospital of Chongqing Medical University120 Longshan Rd. Chongqing401147P.R. China

Yunfei Zhang^1#, Cuilian Ye^2#, Xinzhong³, Xionghui Ding³, YihangYang³, Yue Ma^1¶, Chunbao Guo^1,¶

1 Department of Pediatrics, Chongqing Health Center for Women and Children, Chongqing, China.

2 School of Pharmacy and Bioengineering, Chongqing University of Technology, Chongqing, 400054, P.R. China.

3 Department of Burn, Children’s Hospital of Chongqing Medical University, Chongqing, China.

¶To whom correspondence should be addressed:

Chunbao Guo, M.D., Ph.D., Department of pediatrics, Children’s Hospital of Chongqing Medical University; Department of pediatrics, Chongqing Health Center for Women and Children, Women and Children’s Hospital of Chongqing Medical University, 120 Longshan Rd. Chongqing, 401147, P.R. China. E-mail: guochunbao@foxmail.com, guochunbao@hospital.cqmu.edu.cn.

Yunfei Zhang and Cuilian Ye contributed equally to this work.

Running title

Lack of IL-40 alleviates NEC

Abstract

Necrotizing enterocolitis (NEC) is a severe inflammatory condition that affects premature infants, marked by intestinal necrosis and systemic inflammation. This study examined interleukin-40 (IL-40) levels in patients with NEC and investigated its influence on inflammation, neutrophil function, and the formation of neutrophil extracellular traps (NET) using clinical samples and experimental models. Intestinal tissue samples were obtained from infants diagnosed with NEC and from control subjects, with plasma IL-40 levels subsequently measured. An experimental NEC model was established employing IL-40 knockout (IL-40−/−) and wild-type (WT) mice to assess the effects of IL-40 deficiency on disease progression. Results indicated that IL-40 levels were significantly elevated in NEC patients compared to controls, correlating with enhanced NET formation and greater disease severity. In the murine model, IL-40−/− mice demonstrated reduced NEC severity, lower neutrophil infiltration, and diminished NET release. Mechanistic studies indicated that the absence of IL-40 decreased mitochondrial reactive oxygen species (ROS) production and the release of oxidized mitochondrial DNA (ox-mtDNA), both crucial for NET formation. In conclusion, this study highlights the significant role of IL-40 in NEC by promoting neutrophil activation and NETosis. Targeting IL-40 may present a promising therapeutic approach to mitigate intestinal damage in NEC by inhibiting NETosis and reducing inflammation.

Keywords:

Necrotizing enterocolitis

IL-40

neutrophil

ROS

neutrophil extracellular traps

Introduction

Necrotizing enterocolitis (NEC) is a severe inflammatory condition primarily affecting premature infants, marked by intestinal necrosis and systemic inflammation. Despite advances in neonatal care, NEC remains a leading cause of morbidity and mortality, with death rates exceeding 30% [1]. Its pathogenesis is complex and multifactorial, involving intestinal ischemia-reperfusion injury, dysbiosis, and an exaggerated inflammatory response [2].

Recent research has highlighted the critical role of neutrophils and neutrophil extracellular traps (NET) in NEC's development and progression [3]. NET are web-like structures released by activated neutrophils that trap and neutralize pathogens. However, their release also contributes to significant tissue damage and inflammation [4]. Consequently, there is an urgent need for a novel theranostic biomarker that can both identify patients based on their immunopathologic profiles and serve as a therapeutic target for precision immunotherapy in NEC.

Interleukin-40 (IL-40) is a recently identified cytokine that modulates immune responses, particularly in inflammation and sepsis [5]. Studies have shown that IL-40 has strong pro-inflammatory effects, promoting the release of IFN-γ from B cells, TNF-α and IL-17A from T cells, and matrix metalloproteinases (MMPs) from synovial fibroblasts [6, 7]. Elevated IL-40 expression has been observed in conditions like rheumatoid arthritis, systemic lupus erythematosus, and ankylosing spondylitis, with levels positively correlating with disease activity and autoantibody production [8, 9, 10, 11]. Furthermore, IL-40 has been implicated in promoting neutrophil activation and NETosis, suggesting a potential role in NEC pathogenesis [5]. While neutrophils are recognized as a source of IL-40, its specific regulatory role in NEC has yet to be fully elucidated.

This study aims to investigate the role of IL-40 in NEC by analyzing its levels in affected patients and assessing its potential as a stratification biomarker. We also explore its effects on inflammation, neutrophil function, and NET formation using both clinical samples and experimental models. Our research focuses on the mechanisms involving IL-40, including its influence on neutrophil infiltration and pyroptosis, which contribute to NEC etiology. Additionally, we examine whether a targeted IL-40 knockout strategy can concurrently suppress multiple pro-inflammatory mediators, potentially serving as a therapeutic approach to reduce mortality. Our findings offer new insights into the mechanisms of IL-40-mediated inflammation in NEC and highlight its promise as a therapeutic target.

Methods

Human Tissue Samples

Intestinal tissue samples were collected from infants (1–31 days old) undergoing emergency laparotomy for diagnosed necrotizing enterocolitis (NEC) at the Chongqing Health Center for Women and Children. Control samples were obtained from eight infants who had surgery for congenital conditions unrelated to NEC.

The study, conducted from August 15, 2022, to July 15, 2023, was approved by the Institutional Review Board (IRB) of the Chongqing Health Center for Women and Children (IRB No.: WCHMU2023-036). Informed consent was obtained from the parents or legal guardians of all participating infants.

Murine Model of NEC

All animal protocols were approved by the Animal Care and Use Committee of the Chongqing Health Center for Women and Children. C57BL/6 neonates were sourced from Chongqing Medical University, while IL-40−/− pups were provided by Dr. Hongbo Luo. Five-day-old mice (2.86 ± 0.30 g) were subjected to a protocol involving formula feeding, cold stress, and hypoxia to induce NEC. Mice were monitored for survival for seven consecutive days or humanely euthanized at specific time points for tissue collection. Following euthanasia, blood was collected via cardiac puncture, and peritoneal lavage fluid (PLF) was obtained. The entire intestinal tract was harvested for macroscopic and histological examination. NEC was confirmed through histological evaluation of the terminal ileum, with severity graded according to established criteria [2].

Histological Assessment

On postnatal day nine, surviving mice were humanely euthanized. The terminal ileum was harvested, fixed in 4% buffered formalin for 24–48 hours, and processed for paraffin embedding. Five-micron sections were stained with hematoxylin and eosin (H&E) and digitized using a Digital Pathology Slide Scanner. A blinded pathologist evaluated histological indicators of mucosal injury using a standardized grading system [2].

Endotoxin Assay

Lipopolysaccharide (LPS) concentrations were measured using a photometric detection kit from Beijing Jinshan Science and Technology Co., Ltd. A detection threshold of 10 pg/mL was used, consistent with previous data analysis and manufacturer guidelines [2].

ELISA

Inflammatory cytokine levels were quantified using ELISA kits from R&D. Additionally, 8-hydroxy-2'-deoxyguanosine (8-OHdG) was measured with an ELISA kit from Abcam.

Intestinal Permeability Measurement

Intestinal permeability was assessed by administering fluorescein isothiocyanate (FITC)-labeled dextran (Sigma) via gavage. After four hours, blood was collected, and serum fluorescence concentration was measured to quantify the ingress of FITC-dextran into the bloodstream [2].

SIgA and β-Defensin-2 Measurements

Intestinal mucus was collected by excising the intestinal lumen and flushing it with a buffer containing 0.02% sodium azide. Mucosal components were then assessed for secretory immunoglobulin A (SIgA) and β-defensin-2 using specific ELISA kits.

Isolation of Primary Neutrophils

Mouse Neutrophils: Primary neutrophils were isolated from mouse bone marrow. Following an initial resuspension and centrifugation step, cells were isolated using a mouse bone marrow neutrophil isolation kit (Solarbio Life Sciences). Purity was confirmed to be over 90% by staining with anti-CD11b and anti-Ly6G mAbs.

Human Neutrophils: Human circulating neutrophils were isolated from 10 mL of whole blood from NEC patients or controls. Blood was diluted with phosphate-buffered saline (PBS) and centrifuged with a 1.082 g/mL isotonic Percoll solution. After red blood cell lysis, flow cytometry confirmed a viable neutrophil population exceeding 90%.

NET Induction

Neutrophils were seeded at 5 × 10⁵ cells/mL and stimulated with sterile LPS (30 µg/mL) for four hours to induce neutrophil extracellular trap (NET) formation. Following stimulation, cells were prepared for microscopy, and supernatants were collected to measure NET-related markers including MPO-DNA, PAD4, ROS, and H3Cit.

Immunofluorescence

Five-micron distal ileum sections were mounted on slides, dewaxed, and rehydrated. Antigen retrieval was performed in 10 mM sodium citrate. Tissues were treated with 3% hydrogen peroxide (H₂O₂) to quench endogenous peroxidase activity and blocked with 3% bovine serum albumin (BSA). Sections were labeled with FITC-conjugated anti-IL-40 and PE-conjugated anti-H3Cit. Slides were then coverslipped in Vectashield Antifade with DAPI and examined using a Nikon C1 confocal microscope.

NET Quantification

Levels of MPO-DNA, H3Cit, PAD4, and ROS were measured using corresponding ELISA kits (MEIKE Biotech) and analyzed with a Spark® multimode microplate reader. dsDNA quantification was performed using a Quant-iT™ PicoGreen™ dsDNA Reagent and Kit.

qRT-PCR

Following TRIzol extraction (Invitrogen), 1 µg RNA was reverse-transcribed with SuperScript II and oligo-dT primers. Real-time PCR was run on an ABI 7300 instrument using gene-specific primers (Table 2), and relative expression was calculated via the 2^^–ΔΔCt method.

Table 1
Demographics and characteristics of Human samples.
No.	Sex	birth weight	gestational age	Age(days)	Diseases	Site of collection
Cases
1	F	2210g	30W	18	Necrotizing Enterocolitis	ileum
2	M	1932g	31W	22	Necrotizing Enterocolitis	ileum
3	M	2398g	32W	11	Necrotizing Enterocolitis	ileum
4	F	1317g	27W	16	Necrotizing Enterocolitis	Ileum
5	F	1589g	29W	26	Necrotizing Enterocolitis	ileum&jejunum
6	M	1886g	32W	12	Necrotizing Enterocolitis	ileum
7	F	3191g	30W	8	Necrotizing Enterocolitis	ileum
8	F	2813g	28W	17	Necrotizing Enterocolitis	ileum
9	M	2955g	26W	7	Necrotizing Enterocolitis	jejunum
10	F	2724g	31W	3	Necrotizing Enterocolitis	ileum&jejunum
Control
1	F	2986g	38W	3	Imperforate anus	colon
2	M	3211g	39W	7	Ileal atresia	jejunum
3	M	2728g	33W	2	Ileal atresia	jejunum
4	M	2835g	35W	16	Duodenal septum	jejunum
5	F	2368	31W	8	Ileal atresia	jejunum
6	F	2788g	36W	11	Duodenal septum	jejunum
7	F	2699g	37W	6	Ileal atresia	jejunum
8	M	2946g	37W	8	Ileal atresia	jejunum

Table 2
The Mouse primer sequences for the real-time PCR measurement
Gene	Forward (5′-3′)	Reverse (5′-3′)
CCL6	TTATCCTTGTGGCTGTCCTTG	TGGAGGGTTATAGCGACGAT
JAK3	GCTGTGCCGCTATGACC	CCGCTGGAAGTCCCTCT
Mapk3	TGCTGCGCTTCCGCCATAAGAATGTCATCGGCATCCG	CGGATGCCGATGACATTCTTATGGCGGAAGCGCAGCA
CXCL2	CCAACCACCAGGCTACAG	GCGTCACACTCAAGCTCTG
CCL3	TACAAGCAGCAGCGAGTACC	GAGCAAAGGCTGCTGGTTTC
CCL4	TGTGCTCCAGGGTTCTCAGC	CCAGGGCTCACTGGGGTTAG
CXCL5	GGTCCACAGTGCCCTACG	GCGAGTGCATTCCGCTTA
β-actin	CCCTGGAGAAGAGCTACGAG	CGTACAGGTCTTTGCGGATG

Statistics

Data were analyzed using GraphPad Prism (version 9) and are presented as mean ± SEM. Normality of data distribution was assessed with the Shapiro-Wilk test. Statistically significant differences were determined using a Student's t-test or one-way ANOVA followed by Tukey’s post-hoc multiple comparison test, as appropriate. A P-value of less than 0.05 was considered statistically significant.

Results

1. Analysis of IL-40 Levels in NEC Patients

To evaluate IL-40 involvement in necrotising enterocolitis (NEC), terminal-ileal biopsies were obtained from six infants undergoing emergency laparotomy for acute NEC and from six control infants undergoing non-NEC re-anastomosis. An additional cohort of 24 NEC patients and 20 age-matched healthy volunteers provided plasma for biomarker analysis. NEC patients exhibited significantly higher circulating IL-1β, TNF-α, IL-6, procalcitonin and C-reactive protein than controls (Fig. 1A), together with a pronounced elevation in plasma IL-40 (Fig. 1B).

Fig. 1

Analysis of IL-40 levels in patients with necrotizing enterocolitis (NEC)

(A) Plasma levels of inflammatory markers, including IL-1β, TNF-α, IL-6, procalcitonin, and C-reactive protein, in NEC patients. (B) Plasma levels of IL-40 in NEC patients. (C) Quantification of dsDNA (NET structures) and MPO-DNA complexes in the plasma of NEC patients. (D) Positive correlation between MPO-DNA complex concentration and Sequential Organ Failure Assessment (SOFA) score (Pearson's correlation coefficient r = 0.678, P = 0.0007). (E) Representative fluorescence staining of IL-40 in intestinal tissue sections. Scale bar = 20 µm. (F) Quantification of IL-40 + cells per high-power field in intestinal tissues. Statistical comparisons were made using Student’s t test. *P < 0.01.

Given that IL-40 is released by neutrophils and can potentiate NETosis [15, 18], we next quantified circulating NET markers. Both dsDNA and MPO–DNA complexes were markedly increased in NEC plasma (Fig. 1C) and correlated positively with Sequential Organ Failure Assessment (SOFA) scores (Fig. 1D). Immunofluorescence localised IL-40 predominantly to perivillous regions, with signal intensity significantly higher in NEC terminal ileum than in control tissue (Fig. 1E, F). These data identify IL-40 as a readily detectable, disease-associated mediator that may serve as a diagnostic indicator of NEC severity.

2. IL-40 Deficiency Reduces Inflammation and Protects Against NEC

Expanding on evidence that IL-40 amplifies innate immunity, we tested whether its deletion provides therapeutic benefit in NEC. Following disease induction, both plasma and peritoneal lavage fluid IL-40 concentrations rose sharply (Fig. 2A, B). IL-40⁻/⁻ pups exhibited a markedly higher survival rate than wild-type littermates (Fig. 2C), accompanied by preserved intestinal architecture on H&E sections (Fig. 2D) and significantly lower blinded histopathology scores (Fig. 2E).

Fig. 2

IL-40 deficiency inhibits inflammation in experimental NEC

(A, B) IL-40 levels in mouse plasma and peritoneal lavage fluid (PLF) measured by ELISA. (C) Survival analysis of pups in different treatment groups. (D) Representative hematoxylin and eosin (H&E) staining of intestinal sections from mice. Scale bar = 100 µm. (E) NEC severity scores calculated from morphological changes. (F) Representative Muc2 immunostaining of mouse intestinal tissues. Scale bar = 50 µm. (G) Semi-quantification of Muc2-positive cells per crypt, with twelve fields analyzed per section. (H, I) Concentrations of β-defensin-2 and SIgA measured from mouse intestinal tissue. (J) Transepithelial electrical resistance (TER) levels in pup intestines. (K) Serum FITC-dextran levels as a measure of intestinal permeability. (L) Plasma levels of inflammatory cytokines (IL-1β, IL-6, TNF-α, INF-γ, and IL-10) in mice. (M) Bacterial enumeration from homogenized intestinal tissue. (N) Endotoxin (LPS) levels in pups.

Data were presented as mean ± SEM; statistical analysis was performed using Student’s t-test or one-way ANOVA as appropriate, *P < 0.01, #P < 0.01.

Loss of IL-40 also restored the mucosal immune barrier. NEC-associated increases in Muc2 (Fig. 2F, G) and β-defensin-2 (Fig. 2H) and the concomitant drop in secretory IgA (Fig. 2I) were all reversed in knockout mice. Transepithelial electrical resistance rose and FITC-dextran leakage fell, indicating partial normalization of permeability (Fig. 2J, K).

Systemic cytokine profiling revealed selective down-regulation of IL-6, CCL2 and TNF-α in IL-40⁻/⁻ mice, whereas IFN-γ and IL-10 remained unchanged (Fig. 2L). Finally, bacterial colony counts (Fig. 2M) and plasma LPS levels (Fig. 2N) were significantly reduced. Collectively, these data indicate that IL-40 blockade limits NEC mortality by dampening pro-inflammatory circuits and preserving intestinal barrier integrity.

3. IL-40 Deficiency Attenuates Neutrophil Infiltration and Activation During NEC Development

Neutrophil-rich infiltrates are a histological hallmark of NEC. To determine whether IL-40 governs leukocyte recruitment, we enumerated intestinal granulocytes, macrophages and lymphocytes by flow cytometry. IL-40 deletion markedly reduced the abundance of granulocytes and macrophages (Fig. 3A), whereas lymphocyte numbers remained unchanged (Fig. 3C). Consistently, tissue neutrophil counts were significantly lower in IL-40−/− mice (Fig. 3D, E), implicating IL-40 in the selective recruitment of myeloid cells.

Fig. 3

The impact of IL-40 deficiency on intestinal neutrophil infiltration in NEC

(A–C) Quantification of granulocyte (CD11b + Ly6G+), macrophage (F4/80 + CD11b+), and lymphocyte (CD3+) cell counts in pups. (D) Representative FACS plots of neutrophils (GR-1+/CD45.2+) from intestinal tissues. (E) Quantitative assessment of neutrophils from flow cytometry data. (F) Concentrations of CXCL2 and CCL3 in the terminal ileum measured by ELISA. (G) mRNA expression of CXCL2, CCL3, CCL4, and CXCL5 determined by qRT-PCR.

Data were presented as mean ± SEM; statistical analysis was performed using Student’s t-test or one-way ANOVA as appropriate, *P < 0.01, #P < 0.01.

Mechanistic analysis revealed that NEC challenge elevated intestinal CXCL2 and CCL3 protein concentrations (Fig. 3F); these increases were largely abolished in IL-40−/− animals. By contrast, mRNA levels of CXCL2, CCL3, CCL4 and CXCL5 were comparable between genotypes, indicating that IL-40 regulates these chemokines chiefly at the post-transcriptional level. Collectively, the data position IL-40 as a key facilitator of neutrophil and monocyte trafficking during NEC.

4. IL-40 Influences Neutrophil Activation

To determine whether IL-40 deletion limits neutrophil recruitment independently of bacterial clearance, we used an E. coli-driven peritonitis model. Baseline neutrophil counts in peritoneal lavage were comparably low in naïve WT and IL-40⁻/⁻ mice. Four hours after intraperitoneal injection of live E. coli, WT animals contained ~ 17 × 10⁶ neutrophils, whereas IL-40⁻/⁻ littermates exhibited a 40% reduction (~ 10 × 10⁶; Fig. 4A, B), indicating that IL-40 potentiates acute neutrophil trafficking.

Fig. 4

IL-40 deficiency inhibits neutrophil activation

(A) Representative cytological smear of total cells from peritoneal lavage fluid stained with a modified Wright-Giemsa stain. (B) Quantitative assessment of neutrophils from the cytological smear staining. (C, D) Bacterial colony enumeration from homogenized intestinal tissues after 24 hours of culture. (E, F) Expression levels of MPO and ROS in neutrophils determined by FACS analysis. (G-I) mRNA levels of CCL3, CCL6 and CXCL2 in intestinal tissue quantified by qRT-PCR.

Data were presented as mean ± SEM; statistical analysis was performed using Student’s t-test or one-way ANOVA as appropriate, *P < 0.01, #P < 0.01.

Parallel analyses of the NEC model revealed that IL-40 deficiency also lowers intestinal bacterial load (Fig. 4C, D). Consistent with diminished infection pressure, MPO⁺ neutrophil infiltration and ROS generation in the gut wall were both attenuated in IL-40⁻/⁻ pups (Fig. 4E, F). Transcriptional profiling showed significant down-regulation of the neutrophil-active chemokines CCL3, CCL6 and CXCL2 in knockout intestine (Fig. 4G), implicating IL-40 as a critical amplifier of neutrophil recruitment and oxidative burst during bacterial inflammation.

5. IL-40 Deficiency Protects Against NEC by Mitigating NET Release

To determine whether IL-40 governs NETosis during NEC, we quantified circulating NET markers in IL-40⁻/⁻ pups. Under NEC stress, both dsDNA and MPO–DNA complexes were markedly lower than in wild-type controls (Fig. 5A, B). In-vivo staining of citrullinated histone H3 (H3Cit) confirmed robust NET deposition in WT intestine, whereas signal intensity was significantly reduced in IL-40⁻/⁻ mice (Fig. 5C, D). Consistently, neutrophil ROS and PAD4 expression declined in the knockout group (Fig. 5E), together with down-regulation of JAK3 and MAPK3 transcripts—key nodes in NET-related signalling (Fig. 5F).

Fig. 5

IL-40 deficiency prevents NETosis during NEC development

(A, B) Quantification of dsDNA and MPO-DNA complexes in the plasma of pups. (C, D) Fluorescence micrographs showing superoxide detection with dihydroethidine (DHE) in formalin-fixed intestinal sections. Scale bar = 50 µm. The right panel shows a quantitative analysis of DHE-positive cells from 3–4 fields per sample. (E) Plasma concentrations of ROS and PAD4. (F) mRNA levels of JAK3 and MAPK3 in intestinal tissue quantified by qRT-PCR. (G) Quantification of dsDNA in pup plasma using PicoGreen fluorescent dye. (H) Plasma IL-1β levels detected by ELISA. Data were presented as mean ± SEM; statistical analysis was performed using Student’s t-test or one-way ANOVA as appropriate, *P < 0.01, #P < 0.01.

Adoptive transfer experiments underscored the neutrophil-intrinsic requirement for IL-40: infusion of WT neutrophils into IL-40⁻/⁻ recipients restored NET production, whereas IL-40⁻/⁻ neutrophils failed to do so (Fig. 5G). Parallel decreases in intestinal IL-1β mRNA corroborated diminished inflammatory injury (Fig. 5H). Collectively, these data position IL-40 as an essential driver of NETosis in experimental NEC.

6. IL-40 Induces NETosis via the Mitochondrial ROS/ox-mtDNA Pathway

Mitochondrial-derived reactive oxygen species (mtROS) are potent amplifiers of neutrophil activation. We therefore investigated whether IL-40 governs mitochondrial integrity during NEC. Neutrophils isolated from affected infants exhibited collapsed mitochondrial membrane potential (Δψm; Fig. 6A) and exaggerated mtROS generation (Fig. 6B), accompanied by elevated plasma levels of oxidised mitochondrial DNA (ox-mtDNA; Fig. 6C).

Fig. 6

IL-40 is associated with NET release through the Mitochondrial ROS/ox-mtDNA Pathway

(A) Neutrophil mitochondrial membrane potential (ΔΨm) measured by TMRM staining and FACS analysis. (B) Mitochondrial ROS production in neutrophils from NEC patients. (C) Levels of oxidized mitochondrial DNA (ox-mtDNA) in plasma from NEC patients. (D) Quantification of dsDNA in the supernatant of treated neutrophils. (E–G) Detection of MPO, H3Cit, and PAD4 in neutrophil supernatant. (H, I) Levels of ox-mtDNA in neutrophil supernatant. (J) Levels of dsDNA in neutrophil supernatant. Data were presented as mean ± SEM; statistical analysis was performed using Student’s t-test or one-way ANOVA as appropriate, *P < 0.01, #P < 0.01.

In vitro, LPS challenge triggered robust NET release from wild-type neutrophils, an effect abolished by IL-40 deficiency (Fig. 6D). Concordantly, MPO, citrullinated histone H3 and PAD4 were markedly reduced in LPS-stimulated IL-40⁻/⁻ cells (Fig. 6E–G). Since ox-mtDNA is a critical NET trigger, we quantified 8-oxo-2′-deoxyguanosine (8-OHdG) in culture supernatants. LPS evoked a pronounced increase in neutrophil-derived 8-OHdG that was largely abrogated in IL-40⁻/⁻ neutrophils (Fig. 6H). Scavenging mtROS with the mitochondria-targeted antioxidant MitoTempo not only suppressed ox-mtDNA release (Fig. 6I) but also diminished NET formation (Fig. 6J). Collectively, these data establish that IL-40 promotes NETosis by sustaining mtROS-dependent ox-mtDNA extrusion in NEC.

Discussion

In this investigation, we demonstrated that necrotizing enterocolitis (NEC) is characterized by elevated plasma IL-40 levels, a significant influx of pro-inflammatory neutrophils into the intestines, and the formation of neutrophil extracellular traps (NET). IL-40 deletion diminished NET release and neutrophil-derived inflammatory cytokines, underscoring the crucial role of IL-40 in NETosis. Furthermore, we found that IL-40 positively regulates neutrophil-mediated inflammation through the mitochondrial reactive oxygen species (ROS) pathway. These findings elucidate the mechanisms by which IL-40 signaling regulates neutrophil activity and contributes to intestinal injury in NEC.

The immature neonatal immune system is known to contribute to severe intestinal inflammation in response to infections [12, 13]. Recently, the immunoregulatory role of IL-40 in controlling inflammatory immune responses has gained attention [5, 14], representing a promising avenue for understanding NEC pathogenesis. As a novel cytokine, IL-40 can provoke intestinal inflammation, increase permeability, and compromise the intestinal barrier [15, 16]. This study highlights IL-40’s potential as both a biomarker and a mediator in NEC. Our findings of elevated plasma IL-40 levels in NEC patients align with previous studies that reported neutrophil-related IL-40 expression in the synovial fluid of patients with chronic rheumatoid arthritis [14], further emphasizing its role in immune-mediated inflammation. As a small secretory protein, IL-40 is also easily measurable, enhancing its clinical applicability [17].

Recent research underscores the significance of neutrophils and NET in the initiation and progression of NEC [18, 19, 20]. Our findings confirm that IL-40 plays a pivotal role in neutrophil recruitment and activation during NEC. The absence of IL-40 significantly reduced neutrophil infiltration and the expression of neutrophil-associated chemokines, indicating that IL-40 is a key regulator of neutrophil-mediated inflammation and prevents the entry of these cells into the intestine. We also observed dysregulated NETosis in NEC, with elevated markers in the serum of patients that correlate with MPO-DNA complexes and serum IL-40. This further links IL-40 and activated neutrophils in the early phase of NEC. The reduction in neutrophil counts in IL-40-deficient mice corresponds with decreased inflammatory responses in this model.

In vitro studies showed that peritoneal neutrophils from IL-40 knockout (IL − 40−/−) mice exhibited distinct features, including diminished production of inflammatory cytokines and reduced chemokine expression. While neutrophils aim to eliminate pathogens [21, 22], our data suggest that IL-40 influences bacterial killing independently of its pro-inflammatory effects, indicating that this process may involve multiple mechanisms that warrant further investigation.

Over the past decade, NET have been recognized as a double-edged sword in sepsis [25, 26, 28]. In 2008, NET-related markers were identified in the peripheral blood of septic patients, revealing a significant correlation with poor prognosis [29, 30]. Given that NET production has been observed in rheumatoid arthritis [14] and that IL-40 is associated with NETosis in NEC, we hypothesized that IL-40 may mediate the pathological interactions between neutrophils and NET. Our findings indicate that IL − 40−/−-deficient mice exhibit significantly reduced NET levels under NEC stress. In vivo immunofluorescence and ELISA analyses confirmed that IL-40 deficiency attenuated NETosis-related markers (H3Cit, ROS, PAD4) and dampened the activation of related pathways (JAK3, MAPK3). These results underscore IL-40’s essential role in NET formation and neutrophil activation during NEC. Based on our evidence and the observed upregulation of IL-40, we propose that neutrophils undergoing NETosis are a significant source of IL-40. This is supported by our in vitro data showing that LPS-stimulated neutrophils release IL-40 abundantly as they undergo NETosis. This study thus identifies IL-40 as a key upstream regulator of NET formation in NEC, establishing NETosis as an IL-40-dependent event.

During NEC pathogenesis, activated intestinal neutrophils produce various chemokines and cytokines [31, 32]. We demonstrated that extracellular IL-40 enhances cytokine release from these neutrophils. The mitochondrial-specific antioxidant MitoTempo significantly reduced oxidized mitochondrial DNA (ox-mtDNA) release and NET formation, highlighting the mechanistic link between ROS and NETosis. This finding suggests potential therapeutic benefits in targeting mitochondrial ROS to mitigate IL-40-mediated inflammation and NETosis.

In summary, our study provides new insights into the role of IL-40 in the pathogenesis of NEC. We demonstrate that IL-40 is elevated in the serum of NEC patients and plays a crucial role in neutrophil activation, NETosis, and organ dysfunction. The data suggest that IL-40 requires a specific pro-inflammatory environment, such as that present in NEC. Considering IL-40 as a mediator of NETosis, its inhibition could have significant pharmacological implications for treating diseases characterized by NET-mediated immunopathology, including NEC.

Declarations

Ethics Approval and Consent to Participate

All animal experiments were approved by the Animal Care and Use Committee of Chongqing Medical University.

Written informed consent was obtained from all participants or their legally authorized representatives prior to their participation in the study.

Data Availability

The datasets generated and analyzed during this study are available from the corresponding author upon reasonable request.

Competing Interests

The authors declare no competing interests.

Funding

This work was supported by grants from the National Natural Science Foundation of China (No. 81900001), the Chongqing Natural Science Foundation (Nos. cstc2019jcyj-msxmX0189, CSTB2022NSCQ-MSX0819), the Scientific and Technological Research Program of Chongqing Municipal Education Commission (Grant No. KJZD-K202100406), and the Institute Research Program of Chongqing Health Center for Women and Children (2021YJQN03).

Author Contribution

YZ and CY performed the research, XD and CG designed the research study, XZ and YY contributed essential reagents or tools, YM analysed the data. YM and CG wrote the paper.

Acknowledgement

We thank Miss Siqi Yang for her academic support and Jiaren Liu (Harvard University, USA) for assistance with the linguistic revision of this manuscript.

Electronic Supplementary Material

Below is the link to the electronic supplementary material

Supplementary Material 1

Reference

Kim W, Seo JM, Necrotizing Enterocolitis. N Engl J Med. 2020;383(25):2461. 10.1056/NEJMicm2020782.

Ma Y, Zhang Y, Liu X, Yang X, Guo H, Ding X, Ye C, Guo C. Deletion of CD38 mitigates the severity of NEC in experimental settings by modulating macrophage-mediated inflammation. Redox Biol. 2024;77:103336. 10.1016/j.redox.2024.103336.

MacQueen BC, Christensen RD, Yost CC, Lambert DK, Baer VL, Sheffield MJ, Gordon PV, Cody MJ, Gerday E, Schlaberg R, Lowe J, Shepherd JG. Elevated fecal calprotectin levels during necrotizing enterocolitis are associated with activated neutrophils extruding neutrophil extracellular traps. J Perinatol. 2016;36(10):862–9. 10.1038/jp.2016.105.

Papayannopoulos V. Neutrophil extracellular traps in immunity and disease. Nat Rev Immunol. 2018;18(2):134–47. 10.1038/nri.2017.105.

Navrátilová A, Andrés Cerezo L, Hulejová H, Bečvář V, Tomčík M, Komarc M, Veigl D, Tegzová D, Závada J, Olejárová M, Pavelka K, Vencovský J, Šenolt L. IL-40: A New B Cell-Associated Cytokine Up-Regulated in Rheumatoid Arthritis Decreases Following the Rituximab Therapy and Correlates With Disease Activity, Autoantibodies, and NETosis. Front Immunol. 2021;12:745523. 10.3389/fimmu.2021.745523.

Wang W, Zhao J, Wu S, Fu J, Zhang Y, Peng W. Serum IL-40 increases in patients with rheumatoid arthritis and correlates with some clinical characteristics and comorbidities. Sci Rep. 2024;14(1):28945. 10.1038/s41598-024-80104-y.

Cerezo LA, Navrátilová A, Kuklová M, Prokopcová A, Baloun J, Kropáčková T, Veigl D, Popelka S, Fulín P, Ballay R, Pavelka K, Vencovský J, Šenolt L. IL-40 is up-regulated in the synovial fluid and cartilage of osteoarthritis patients and contributes to the alteration of chondrocytes phenotype in vitro. Arthritis Res Ther. 2024;26(1):146. 10.1186/s13075-024-03372-z.

Bani-Wais DFN, Ad'hiah AH. A novel intergenic variant, rs2004339 A/G, of the gene encoding interleukin-40, C17orf99, is associated with risk of rheumatoid arthritis in Iraqi women. Mol Immunol. 2023;164:39–46. 10.1016/j.molimm.2023.11.002.

Navrátilová A, Bečvář V, Hulejová H, Tomčík M, Štolová L, Mann H, Růžičková O, Šléglová O, Závada J, Pavelka K, Vencovský J, Šenolt L, Andrés Cerezo L. New pro-inflammatory cytokine IL-40 is produced by activated neutrophils and plays a role in the early stages of seropositive rheumatoid arthritis. RMD Open. 2023;9(2):e002894. 10.1136/rmdopen-2022-002894.

10.

Guggino G, Rizzo C, Mohammadnezhad L, Lo Pizzo M, Lentini VL, Di Liberto D, La Barbera L, Raimondo S, Shekarkar Azgomi M, Urzì O, Berardicurti O, Campisi G, Alessandro R, Giacomelli R, Dieli F, Ciccia F. Possible role for IL-40 and IL-40-producing cells in the lymphocytic infiltrated salivary glands of patients with primary Sjögren's syndrome. RMD Open. 2023;9(2):e002738. 10.1136/rmdopen-2022-002738.

11.

Jaber AS, Ad'hiah AH. A novel signature of interleukins 36α, 37, 38, 39 and 40 in ankylosing spondylitis. Cytokine. 2023;162:156117. 10.1016/j.cyto.2022.156117. Epub 2022 Dec 29. Erratum in: Cytokine. 2023;166:156195. doi: 10.1016/j.cyto.2023.156195.

12.

13.

Zhang Y, Yan M, Xia Y, Yue Y, Wang S, Hu Y, Lai G, Wu Q, Liu Q, Ding X, Guo C. Glutaredoxin-1 modulates the NF-κB signaling pathway to activate inducible nitric oxide synthase in experimental necrotizing enterocolitis. Mol Ther Methods Clin Dev. 2024;32(1):101214. 10.1016/j.omtm.2024.101214.

14.

Cai S, Li X, Zhang C, Jiang Y, Liu Y, He Z, Ma S, Yao Y, Wong CK, Wu G, Gao X. Inhibition of Interleukin-40 prevents multi-organ damage during sepsis by blocking NETosis. Crit Care. 2025;29(1):29. 10.1186/s13054-025-05257-2.

15.

Catalan-Dibene J, Vazquez MI, Luu VP, Nuccio SP, Karimzadeh A, Kastenschmidt JM, Villalta SA, Ushach I, Pone EJ, Casali P, Raffatellu M, Burkhardt AM, Hernandez-Ruiz M, Heller G, Hevezi PA, Zlotnik A. Identification of IL-40, a Novel B Cell-Associated Cytokine. J Immunol. 2017;199(9):3326–35. 10.4049/jimmunol.1700534.

16.

17.

Nussrat SW, Ad'hiah AH. Interleukin-40 is a promising biomarker associated with type 2 diabetes mellitus risk. Immunol Lett. 2023;254:1–5. 10.1016/j.imlet.2023.01.006.

18.

Brinkmann V, Reichard U, Goosmann C, Fauler B, Uhlemann Y, Weiss DS, Weinrauch Y, Zychlinsky A. Neutrophil extracellular traps kill bacteria. Science. 2004;303(5663):1532–5. 10.1126/science.1092385.

19.

Hemmling H, Hallberg LAE, Hägglund P, Hawkins CL. Histones in neutrophil extracellular traps (NET) contain oxidative post-translational modifications induced by the myeloperoxidase oxidant hypochlorous acid. Redox Biol. 2025;84:103696. 10.1016/j.redox.2025.103696.

20.

Klinke M, Chaaban H, Boettcher M. The role of neutrophil extracellular traps in necrotizing enterocolitis. Front Pediatr. 2023;11:1121193. 10.3389/fped.2023.1121193.

21.

Kinsella RL, Sur Chowdhury C, Smirnov A, Mreyoud Y, Kimmey JM, Esaulova E, McKee SR, Pride A, Kreamalmeyer D, Artyomov MN, Stallings CL. ATG5 suppresses type I IFN-dependent neutrophil effector functions during Mycobacterium tuberculosis infection in mice. Nat Microbiol. 2025;10(6):1323–39. 10.1038/s41564-025-01988-8.

22.

Chowdhury CS, Kinsella RL, McNehlan ME, Naik SK, Lane DS, Talukdar P, Smirnov A, Dubey N, Rankin AN, McKee SR, Woodson R, Hii A, Chavez SM, Kreamalmeyer D, Beatty W, Mattila JT, Stallings CL. Type I IFN-mediated NET release promotes Mycobacterium tuberculosis replication and is associated with granuloma caseation. Cell Host Microbe. 2024;32(12):2092–e21117. 10.1016/j.chom.2024.11.008.

23.

Ku TH, Ram-Mohan N, Zudock EJ, Abe R, Yang S. Neutrophil extracellular traps have active DNAzymes that promote bactericidal activity. Nucleic Acids Res. 2025;53(3):gkae1262. 10.1093/nar/gkae1262.

24.

Lee TJ, Liao HC, Salim A, NETtleford SK, Kleinman KL, Carlson BA, Prabhu KS. Selenoproteome depletion enhances oxidative stress and alters neutrophil functions in Citrobacter rodentium infection leading to gastrointestinal inflammation. Free Radic Biol Med. 2025;227:499–507. 10.1016/j.freeradbiomed.2024.12.025.

25.

Brinkmann V, Zychlinsky A. Beneficial suicide: why neutrophils die to make NET. Nat Rev Microbiol. 2007;5(8):577–82. 10.1038/nrmicro1710.

26.

Carmona-Rivera C, Carlucci PM, Goel RR, James E, Brooks SR, Rims C, et al. Neutrophil extracellular traps mediate articular cartilage damage and enhance cartilage component immunogenicity in rheumatoid arthritis. JCI Insight. 2020. https://doi.org/10.1172/jci.insight.139388.

27.

Papayannopoulos V. Neutrophil extracellular traps in immunity and disease. Nat Rev Immunol. 2018;18(2):134–47. 10.1038/nri.2017.105.

28.

Margraf S, Lögters T, Reipen J, Altrichter J, Scholz M, Windolf J. Neutrophil-derived circulating free DNA (cf-DNA/NET): a potential prognostic marker for posttraumatic development of inflammatory second hit and sepsis. Shock. 2008;30(4):352–8. 10.1097/SHK.0b013e31816a6bb1.

29.

Chu C, Wang X, Yang C, Chen F, Shi L, Xu W, et al. Neutrophil extracellular traps drive intestinal microvascular endothelial ferroptosis by impairing Fundc1-dependent mitophagy. Redox Biol. 2023;67:102906.

30.

Han D, Wu Y, Lu D, Pang J, Hu J, Zhang X, Wang Z, Zhang G, Wang J. Polyphenol-rich diet mediates interplay between macrophage-neutrophil and gut microbiota to alleviate intestinal inflammation. Cell Death Dis. 2023;14(10):656. 10.1038/s41419-023-06190-4.

31.

Zhang X, Tian B, Deng Q, Cao J, Ding X, Liu Q, Zhang Y, Ye C, Deng C, Qiu L, Guo C. Nicotinamide riboside relieves the severity of experimental necrotizing enterocolitis by regulating endothelial function via eNOS deacetylation. Free Radic Biol Med. 2022;184:218–29. 10.1016/j.freeradbiomed.2022.04.008.

32.

Li X, Li X, Shang Q, Gao Z, Hao F, Guo H, Guo C. Fecal microbiota transplantation (FMT) could reverse the severity of experimental necrotizing enterocolitis (NEC) via oxidative stress modulation. Free Radic Biol Med. 2017;108:32–43. 10.1016/j.freeradbiomed.2017.03.011.

Abbreviations:

female

male.

Yes