A
Effects of dietary malic acid and ginger powder supplementation on growth, immunity, antioxidant status, and disease resistance in grass carp (Ctenopharyngodon idella)
SeyyedEhsanSaberi2Email
AfshinGhelichi1Email
RezaAkrami1✉Email
FariborzGhojoghi1✉Email
SaraJorjani1✉Email
1
A
A
A
Department of Fisheries, Young researchers and elite clubIslamic Azad UniversityAzadshahr branchAzadshahrIran
2
A
Department of Fisheries, Azadshahr BranchIslamic Azad UniversityAzadshahrIran
Seyyed Ehsan Saberi 1, Afshin Ghelichi 2*, Reza Akrami 2, Fariborz Ghojoghi 2, Sara Jorjani 2
Department of Fisheries, Young researchers and elite club, Azadshahr branch, Islamic Azad University, Azadshahr, Iran 1
Department of Fisheries, Azadshahr Branch, Islamic Azad University, Azadshahr, Iran 2
1Seyyed Ehsan Saberi: s.saberi940@iau.ir, https://orcid.org/0009-0003-3723-5700
2Afshin Ghelichi: afshin.ghelichi@iau.ac.ir, https://orcid.org/0000-0002-7552-8972 (Corresponding Author)
2Reza Akrami: akrami@iau.ac.ir, https://orcid.org/0000-0002-8932-3142
2Fariborz Ghojoghi: fariborz.ghojoghi@iau.ac.ir, https://orcid.org/0000-0001-6694-1223
2Sara Jorjani: sara.jorjani@iau.ac.ir, https://orcid.org/0000-0002-9101-7689
Abstract
The present study investigated the effect of dietary supplements of malic acid (MA) and ginger powder (Zingiber officinale) (GP), individually and in combination, on the growth and health status of grass carp (Ctenopharyngodon idella). Fish with initial body weight of 4.4 ± 0.01 g were allocated to four treatments with three replicates and were fed with an un-supplemented diet (control, T0), 0.25% MA (T1), 0.2% GP (T2), and combination of both elements (0.25% MA + 0.2% GP, T3) for 8 weeks then were challenged with Aeromonas hydrophila infection. The results showed that the T1, T2 and T3 treatments exhibited significantly higher values for final weight (FW) as compared to the T0 (P < 0.05). A notable reduction was observed in triglyceride level in fish fed supplemented diets (P < 0.05). The addition of MA and GP did not yield any significant impact on the content of the urea (P > 0.05). Immunoglobulin, total immunoglobulin, and lysozyme levels were significantly higher in the T1, T2, and T3 compared to the T0 (P < 0.05). Serum antioxidant enzymes including glutathione peroxidase (GPX), superoxide dismutase (SOD), catalase (CAT) significantly increased in supplemented diets and they were notably higher in T2 and T3 (P < 0.05). Immune-related genes (IL6, IL10) and antioxidant related gene (CAT, GPX) were upregulated in T1, T2 and T3 compared to T0 (p < 0.05). The highest mortality rates following a challenge with A. hydrophila were seen in T0. In conclusion, dietary supplementation with 0.25% malic acid (MA) and 0.2% ginger powder optimally enhances grass carp growth, immunity, and disease resistance, offering a natural alternatives to antibiotics in sustainable aquaculture.
Keyword:
Malic acid
Ginger (Zingiber officinale)
Ctenopharngodon idella
Antioxidative status
Gene expression
Immunity
A
Introduction
A
Aquaculture is rapidly expanding to meet the growing global demand for high-quality animal protein (El-dweny et al., 2025). The grass carp (Ctenopharyngodon idella) holds a position of paramount significance among the cultivated freshwater fish, as it contributes accounting for over 10% of global freshwater aquaculture production (FAO, 2018). However, this species is susceptible to bacterial diseases, which poses a challenge to the aquaculture industry (Qin et al., 2019). The bacterial enteritis caused by A. hydrophila is considered to be a highly prevalent ailment in the cultivation of grass carp (Song et al., 2014). In recent decades, there has been extensive utilization of antibiotics in the aquaculture industry to mitigate and control bacterial disease outbreaks. However, the excessive administration of antibiotics has led to a surge in bacterial resistance to these drugs, thereby causing detrimental effects on both food safety and the environment (Done et al., 2015). The possible alternative to antibiotic additives involves the utilization of additives as immune stimulators that enhance the ability of aquatic animals to resist diseases by improving innate defense mechanisms (Fuchs et al., 2015). Commercially available additives, such as probiotics, Bacillus subtilis and Lactobacillus spp., are live microorganisms that colonize the gut, inhibit pathogenic bacteria through competitive exclusion, and enhance immune responses and prebiotics, mannan oligosaccharides (MOS) and inulin, are non-digestible dietary fibers that selectively stimulate the growth and activity of beneficial gut microbes, thereby supporting mucosal immunity and gut integrity as well as, organic acidifiers, including malic, citric, and formic acids, lower the pH of the gastrointestinal tract, creating unfavorable conditions for harmful bacteria while improving nutrient digestibility and intestinal function (Lückstädt, 2008; Hoseinifar et al., 2020; Yilmaz et al., 2022).
In recent years, there has been a considerable amount of research dedicated to examining the utilization of medicinal herbs, owing to their various benefits including sustainability and reduced adverse reactions, valid alternatives to chemicals and antibiotics cost-benefit implications, health-promoting effects (Ahmadifar et al., 2021).
Ginger (Zingiber officinale) is a prime example, which encompasses the qualities of an edible plant, spice, and medicinal herb (Mohammadi et al., 2020). Bioactive components present in the rhizomes of ginger encompass terpenes, oleoresin, zingiberol, zingiberone, zingiberene, gingerol, shogaol, zingerone, and paradol (Jesudoss et al., 2017). In aquaculture, ginger extract and powder improve growth performance and health status of juvenile beluga, Huso huso, (Vahedi et al., 2017), juvenile rockfish, Sebastes chlegeli, (Kim et al., 2018), zebrafish, Danio rerio, (Ahmadifar et al., 2019), and common carp, Cyprinus carpio, (Mohammadi et al., 2020).
Malic acid (MA), a dicarboxylic acid consisting of four carbon atoms, is naturally present in various organic acids found in fruits (Sniffen et al., 2006) that playing a role in pH regulation (Hassaan et al., 2018). Additionally, malic acid serves as an effective means of microbial control, as it effectively inhibits the growth of pathogenic bacteria and fungi (Ricke, 2003). In the study by Hassaan et al. (2020) dietary supplementation with 5 g/kg MA for 84 days improved growth performance and immune response in Nile tilapia (Oreochromis niloticus). Similarly, the inclusion of 0.25% malic acid in the diet of rainbow trout (Oncorhynchus mykiss) for 8 weeks had a positive effect on their growth and health (Yousefi et al., 2023). Furthermore, in Carassius auratus gibelio, a combination of 0.2% malic acid and 0.2% citric acid for 8 weeks enhanced overall fish health (Zhang et al., 2020).
To the best of our understanding, there have been no previous investigations focusing on the combined impact of malic acid and ginger powder on fish growth performance and health. The malic acid is utilized as a flavor enhancer in food products (Hassaan et al., 2018) so using malic acid with ginger powder have a masking effect on the unpleasant taste of ginger and may preserve the bioactive compounds and antioxidant properties of ginger. Grass carp is economic importance in freshwater aquaculture across many regions, particularly in Asia. Despite its widespread use, grass carp are known to be susceptible to various stress-related and immune challenges under intensive farming conditions. However, nutritional strategies aimed at enhancing immunity and growth performance in this species are still limited compared to model fish like zebrafish or commonly studied species such as common carp. Therefore, the present study was designed to evaluate the individual and combined effects of dietary ginger powder and malic acid on growth performance, hematological parameters, innate immune responses, antioxidant enzyme activities, and resistance against Aeromonas hydrophila in grass carp. In addition, the study aimed to investigate the expression levels of key immune- and antioxidant-related genes in liver and head kidney tissues. This integrated approach seeks to provide novel insights into the potential of these natural dietary additives to enhance health status, immune competence, and disease resistance in aquaculture species.
2. Material and methods
2 − 1. Experimental diets
A basal diet (Table 1) was prepared and enhanced with malic acid (MA) (DL-Malic acid; Merck Millipore, Darmstadt, Germany) and ginger powder (GP), leading to the formation of four distinct diets. In summary, the required quantities of ingredients were accurately measured and meticulously integrated and blended in the mixer (P310, Pars Electric, Tehran, Iran). Subsequently, MA and GP were introduced to a 1000 g mixture of dry ingredients in order to attain the desired concentrations of 0.25% MA, 0.2% GP, and a combination of both components (0.25% malic acid, 0.2% ginger powder) (referred to as T0, T1, T2, and T3). The determination of the quantities of malic acid and ginger powder used in the experiment was carried out by referring to the previous studies conducted by Mohammadi et al (2020) and Zhang et al. (2020). Subsequently, the dough that was prepared underwent the process of being transformed into pellets using a meat grinder (MG1400R, Pars Khazar, Tehran, Iran), followed by drying at ambient temperature for a duration of 24 hours. The resulting dried dough was then ground into particle sizes that were deemed desirable and subsequently stored at a temperature of -20 ˚C until it was ready to be used at a later time.
Click here to Correct
Table 1
Ingredients and proximate compositions (g kg− 1 diet) of the fish experimental diets
A
Table 2
The list of primers for the expression of selected genes in fish
Gene
Primer
(5'->3')
Length(pb)
Tm (° C)
GC%
CAT
Forward
Reverse
TGGGTGGAGACAAATGAAGA
GAACTCGGGGTCTGTCTAAA
20
20
56/36
56/59
45/00
50/00
GPX
Forward
Reverse
GAGGCACAACAGTCAGGGAT
TCCTGATGTCCGAACTGGTT
20
20
59/67
58/65
55/00
50/00
IL.6
Forward
Reverse
GAAACTCCTGAAGCCTGTGT
TATGACAGACAGGAAGAGCG
20
20
57/74
56/76
50/00
50/00
IL.10
Forward
Reverse
TACATCTCCTCTCTTCTGGG
AGCAGAAGCATGACTAGAGC
20
20
55/05
57/40
50/00
50/00
GAPDH
Forward
Reverse
CCATCACAGCCACACAGAAG
TGGAGGCTGGGATAATGTTC
20
20
58/84
56/97
55/00
50/00
2–2. Feeding experiment
A
Healthy grass carp were obtained from a private breeding center (Golestan, Iran) and transported to the aquaculture laboratory located in technical and professional center of Gorgan (Golestan, Iran). All fish were accommodated in tanks (1000 L) and underwent a process of acclimation to the experimental conditions for a duration of two weeks, during which they were provided with a basic diet, 4% of their body weight twice daily. In this study, 240 individuals (4.4 ± 0.01 g) were randomly divided in twelve 150-L tanks with a density of 20 fish in each tank (four treatments with three replications). The fish were then given the experimental diets until they reached a state of apparent satiation, three times a day (at 7:30, 12:30, and 17:30), for 8 weeks (Qin et al., 2019). The tanks underwent a daily siphoning procedure with the objective of eliminating fecal matter, whereby 25% of the water volume was siphoned and replaced with freshwater every day before the first feeding time in the morning. The measurement of water physicochemical factors (dissolved oxygen, temperature, pH levels and water flow rate) in the experimental period were maintained at values of 7.13 ± 0.21 mg/l, 27.6 ± 1.2°C, 6.99 ± 0.05 mg l− 1, and 0.8 L s − 1 respectively. A mercury thermometer (Zomorodazma Company, Iran) and Cyberscan Eutech instruments (DO 110, Singapore) were used to measure temperature and dissolved oxygen.
2–3. Growth efficiency
After 8 weeks, feeding was stopped for 24 hours and all fish were subjected to anaesthetization through the administration of 50 mg/L of MS-222. Subsequently, the fish were individually weighed and the growth factors were determined by following formula (Zhang et al., 2020; Yousefi et al., 2019; Chekani et al., 2021):
Weight gain (WG) = final weight (g) – initial weight (g)
Specific growth rate (SGR) = Ln final weight-Ln initial weight/ days ×100
Feed conversion ratio (FCR) = dry weight of feed given (g) / WG (g)
Survival rate (%) = (final number of fish/initial number of fish) ×100
2–4. Sampling
After 8 weeks, a total of 6 fish per tank were chosen in a random manner and subjected to the process of anaesthetization by the administration of 50 mg/L of MS-222 (Zhang et al., 2019). Blood samples were procured from the caudal vein through the method of venipuncture. Subsequently, these samples were divided into tubes and centrifuged at 1600 g for 10 minutes. The serum was then stored at a temperature of -70°C for subsequent analysis. Following the collection of blood samples, the fish were dissected and the intestine from two fish per tank (six fish per treatment) was meticulously detached. This particular tissue was promptly frozen using liquid nitrogen and ultimately preserved at a temperature of -80°C for the purpose of conducting a gene expression assay.
2–5. Serum factors
Total levels of immunoglobulin (total Ig) were evaluated using the polyethylene glycol precipitation method for Ig and subsequent deduction of initial and final total protein, as outlined by Siwicki and Anderson (Siwicki, 1993). Lysozyme (LYZ) activity was quantified following the method described by Saurabh and Sahoo (Saurabh and Sahoo, 2008) using turbidimetric analysis. Immunoglobulin (IgM, Eastbiopharm) Glutathione peroxidase (GPx, ZelBio), superoxide dismutase (SOD, ZelBio), catalase (CAT, ZelBio), total protein (Bionik), urea (Pars Azmon), and triglyceride (Zistchimi) were analyzed by means of diagnostic reagent kits (Armobin et al., 2023).
2–6. Gene expression
A
At the end of the experiment, six fish (per treatment) were killed with a high dose of anesthetic and placed on ice. The fish's intestines form two fish per tank were removed and stored in a nitrogen tank and stored in a -80°C. First, RNA extraction was performed with the extraction EZ-10 spin column total RNA mini-prep kit (Takara, Japan). Then, the quality and quantity of extracted RNA was carried out by means of the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, USA). After confirming the quality of RNA, cDNA synthesis was performed using Revert Aid first strand cDNA synthesis kit (Takara, Japan). The quantification of cDNA was evaluated using a spectrophotometer manufactured by Thermo Fisher Scientific (Wilmington, USA). Quantitative PCR (qPCR) was performed using RealQ Plus Master Mix Green (AMPLIQONIII) in accordance with the manufacturer’s protocol. Each reaction contained 10 µL of SYBR Green master mix, 1 µL of diluted cDNA, 0.5 µL of each primer, and deionized water (Millipore) to reach a final volume of 20 µL. The thermal cycling conditions were as follows: initial denaturation at 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C for 40 seconds, and extension at 72°C for 35 seconds. Gene expression levels were quantified using the 2−ΔΔCT method described by Livak and Schmittgen (2001). All experiments were conducted in three independent biological replicates.
2–7. Challenging test with Aeromonas hydrophila
A. hydrophila (ATCC 7966) was procured from the Iranian Biological Resource Center (Tehran, Iran). The bacterial specimens were cultivated at a temperature of 25°C for the duration of one night and subsequently subjected to centrifugation (at 3000 g for 15 min) (Ahmadifar et al., 2022). The upper layer was removed and the cell pellet was cleaned with phosphate saline buffer (PBS, 0.1 M, pH7.2) three times by centrifugation at 3000xg for 15 min. Finally, the cell pellet was suspended in PBS. The bacteria concentration was measured with a spectrophotometer at the wavelength of 540 nm and adjusted to 108 CFU. After the eight-week feeding trial, 10 fish per tank (30 fish per treatment) were taken and injected with 0.1 mL of bacterium suspension at 108 CFU per fish (Yousefi et al., 2021). The dead fish were taken out and recorded every day and the mortality rate (%) was calculated for 14 days.
Statics
All the data were subjected to analysis using version 22 of the SPSS software with a confidence level of 95%. Initially, the normality of the data was assessed using the Kolmogorov-Smirnov test and the homogeneity of variance was assessed using Levene's test. One-way analysis of variance (ANOVA) was applied, and the assessment of distinctions between treatments was conducted using Duncan's multiple range test. In order to evaluate the survival rates in the challenge test, the Kaplan-Meier survival analyses were utilized along with a log-rank test at a significance level of 0.05.
3. Results
3 − 1. Growth efficiency
A noticeable difference was observed in FW between various treatments, with the highest FW being noted in T3 which was not significantly different with T2 (Table 3, p < 0.05). WG and SGR were not affected by supplemented diets (Table 3, p > 0.05). FCR experienced a notable decrease in fish that were provided with supplemented diets specially in T2 and T3 (Table 3, p < 0.05). There was no mortality during feeding trial.
Table 3
Growth performance and feed utilization of grass carp fed with dietary 0.25% malic acid (T1) and 0.2% ginger powder (T2) in separate and in combination (T3) for 56 days in comparison with control group (T0).
Treatments
Initial weight (g)
Final weight (g)
Weight gain (g)
FCR
SGR
Survival rate %
T0
4.44 ± 0.12a
7.62 ± 0.09a
3.18 ± 0.20a
3.80 ± 0.24b
0.96 ± 0.06a
100
T1
4.40 ± 0.09a
8.18 ± 0.13b
3.78 ± 0.22a
3.19 ± 0.18b
1.11 ± 0.06a
100
T2
4.37 ± 0.08a
8.38 ± 0.10b
4.01 ± 0.15a
3.00 ± 0.11a
1.16 ± 0.05a
100
T3
4.43 ± 0.11a
8.49 ± 0.13b
4.06 ± 0.21a
2.97 ± 015a
1.16 ± 0.06a
100
* FW: finial weight; WG: weight gain; FCR: food conversion ratio; SGR: specific growth rate; SR: survival rate.
* Values in row assigned with different letter denote significant difference (P < 0.05). Data are presented as mean ± SD.
* Control group (T0), 0.25% malic acid (T1) and 0.2% ginger powder (T2) in separate and in combination (T3)
3–3. Serum Biochemical and Immune Parameters
Grass carp fed the combined diet containing MA and GP (T3) exhibited a significantly higher total protein level compared to the control group (Fig. 1A; p < 0.05). Supplementation with MA and GP, either individually or in combination, led to a significant reduction in serum triglyceride levels (Fig. 1B; p < 0.05). However, no significant differences were observed in serum urea concentrations among the experimental groups (Fig. 1C; p > 0.05). Dietary inclusion of MA and GP also significantly enhanced non-specific immune responses. Specifically, lysozyme activity (Fig. 2A), total immunoglobulin (Fig. 2B), and IgM levels (Fig. 2C) were significantly elevated in all treatment groups compared to the control, with the highest values consistently recorded in the T3 group (p < 0.05).
3–5. Antioxidant Enzyme Activities
The activities of CAT, GPx, and SOD were significantly elevated in fish receiving diets supplemented with MA and GP (Figs. 3A–C; p < 0.05), with the T3 group showing the greatest enhancement across all antioxidant enzymes.
3–6. Gene expression
The experimental groups, which were provided with diets containing MA and GP, displayed a noteworthy increase in the relative expression levels of CAT (Fig. 4A) and GPX (Fig. 4B) in comparison to the control group (P < 0.05). Remarkably enhanced levels of cytokines, including IL6 (Fig. 5A), and IL10 (Fig. 5B), were observed in the experimental groups that received diets supplemented with MA and GP, when compared to the control group (P < 0.05).
3–7. Challenge with A. hydrophila
Fish challenged with A. hydrophila had variable survival rate and low mortality (Fig. 6) and high survival rate (Table 4) were evidenced in fish fed supplemented diets compared to the control. (P < 0.05).
Table 4
Survival rate (%) of grass carp fed with dietary 0.25% malic acid (T1) and 0.2% ginger powder (T2) in separate and in combination (T3) for 56 days in comparison with control group (T0), 14 days post challenge with Aeromonas hydrophila.
Treatment
Mortality rate (%)
Survival rate (%)
RPS
T0
72.22 ± 5.55b
27.78 ± 5.55a
-
T1
66.67 ± 0.00ab
33.33 ± 0.00ab
7.69
T2
55.56 ± 5.56ab
44.44 ± 5.56ab
23.08
T3
50.00 ± 0.00a
50.00 ± 0.00b
30.77
* Different letters within a row denote significant differences (p < 0.05).
*Control group (T0), 0.25% malic acid (T1) and 0.2% ginger powder (T2) in separate and in combination (T3)
4. Discussion
In the aquaculture industry, the utilization of dietary medicinal herbs and acidifiers as immunostimulants and growth promoter has the potential to enhance growth performance and the innate defense mechanisms of fish in combating pathogens during times of stress (Haghighi and Sharif Rohani, 2013; Ahmadifar et al.,2021). In this study, the utilization of malic acid and ginger powder, whether used individually or in combination, has demonstrated significant enhancements on the various growth factors in the grass carp. Similarly, organic acids or salts improve growth efficiency in Nile tilapia (Hassaan et al., 2018, 2020; Reda et al., 2016) and rainbow trout (De Wet, 2005). Ahmadifaret al. 2020 found that dietary ginger (Zingiber officinale) alters biochemical and immunological parameters and gene expression related to growth, immunity and antioxidant system in zebrafish (Danio rerio). Jafarinejad, et al 2020 in investigation of dietary ginger growth performance, blood parameters, antioxidant capacity and gene expression in Cyprinus carpio reported a significant increase in growth parameters (final weight, weight gain, specific growth rate, food conversion ratio) in the treatment groups by 2% and 5% compared to the control group. In 2017, Vahedi et al. investigated the effects of ginger extract on farmed beluga (Huso huso) and found no significant difference in the growth factors of all treatment groups compared to the control group.
By investigating the effects of malic acid at levels of 0, 0.5, 1, 2% over a period of 60 days on common carp, Safari et al. (2021) found a significant increase in the growth performance, expression of the genes related to immunity and the genes related to antioxidant activity in the skin of the fish in the 2% malic acid treatment group (P < 0.05). In their study, there was no significant difference in genes related to growth among different groups. Yousefi et al. (2023) showed that dietary use of malic acid at the rate of 0.25% in O. mykiss diets improved the antioxidant status and immune responses of the fish without any negative effect on growth performance.
Also, increased growth in fish fed diets supplemented with ginger was observed in Labeo rohita (Sukumaran et al., 2016), common carp, Cyprinus carpio, (Mohammadi et al., 2020), and Nile tilapia (Brum et al., 2017). The increase in growth that occurs as a result of adding ginger to the diet can be attributed to the heightened release of intestinal proteases by the host, which in turn improves the process of digesting and absorbing protein components from the feed (Mohammadi et al., 2020). Additionally, the rhizomes of ginger serve as a plentiful source of proteinase, further enhancing protein digestion and the absorption of amino acids within the gastrointestinal tract (Hashim et al., 2011). Furthermore, ginger also has a positive impact on the probiotic bacterial population within the intestines and aids in the acquisition of even more nutrients (Ali et al., 2008). The mechanisms by which organic acids exert their effects seem to be distinct. Several hypotheses have been proposed to explain the impacts of organic acids on improving nutrient utilization in animals. These hypotheses encompass the following: the reduction of gastric pH, which in turn enhances pepsin activation; the decrease in intestinal pH, potentially leading to increased solubilization of minerals and subsequent enhanced absorption; or the inhibition of intestinal microbial activity, which would otherwise compete for nutrients that are now available for the host animal (De Wet, 2005; Hassaan et al., 2018). The utilization of malic acid as a flavor enhancer in food products has been documented by Hassaan et al. (2018). Consequently, the combination of malic acid with ginger powder may have a mitigating impact on the disagreeable taste of ginger, while simultaneously potentially maintaining the bioactive compounds and antioxidant properties of ginger.
The metabolic status of fish can be delineated through the analysis of serum biochemical indicators (Zhang et al., 2020). The present study, the concentrations of total protein displayed a noteworthy increase in fish fed-supplemented diets in comparison to the control group. Previous research conducted by other scientists has also demonstrated the beneficial impact of ginger supplementation on the levels of total protein in Zebra fish (Ferri-Lagneau et al., 2012), rainbow trout (Nya et al., 2009), and common carp (Mohammadi et al., 2020). Similar to the findings on malic acid supplementation have been found to significantly enhance total protein (Hassaan et al., 2017). The elevated levels of total protein is indicative of improved health and immune function in fish. Triglycerides, which are stored in adipose cells and between muscles and skin, are regarded as the primary forms of fat within the body (Banaee et al., 2011). In this study, the level of triglyceride reduced in fish fed-supplemented diets compared to the control group. Similar to our results, lower triglycerides level were reported in common carp fed herb extract (Raissy et al., 2022), and malic acid-fed Siberian sturgeon (Acipenser baerii) (Alizade et al., 2019). The notable reductions in blood triglycerides observed in these treatments can be ascribed to the impact of this extract on their accumulation in adipose tissues.
Dietary supplementation of malic acid and ginger extract has been demonstrated to enhance the immune response of grass carp, thereby bolstering their ability to resist diseases (Mohammadi et al., 2020; Hassaan et al., 2020). In this study, immune factors (total Ig, IgM, and LYZ) and their related genes (IL6 and IL10) increased significantly in fish fed malic acid and ginger powder. Similar to our results, higher LYZ, Ig levels were reported in rainbow trout fed with ginger powder (Nya et al., 2009; Haghighi and Rohani, 2013), ginger-fed common carp (Mohammadi et al., 2020), malic acid-fed rainbow trout (Yousefi et al., 2023), and the ferulic acid-fed hybrid grouper (Fu et al., 2022) than in fish fed with non-supplemented (the control) diets. Ahmadifar et al. (2019) observed a notable increase in serum Ig content following the administration of powdered ginger rhizomes at a supplementation rate of 3% in zebrafish. Correspondingly, Dawood et al. (2020) demonstrated that the inclusion of ferulic acid in the diet significantly enhanced serum LYZ in Nile tilapia exposed to heat stress. Mousavi et al., following the consumption of the grape seed extract (GSE) the expression of LYZ was upregulated in the rainbow trout (Mousavi et al., 2021). IL-6 is a pro-inflammatory cytokine involved in the early activation of the innate immune response, playing a key role in the acute phase reaction and defense against pathogens. In contrast, IL-10 is an anti-inflammatory cytokine that helps regulate immune homeostasis by suppressing excessive inflammatory responses (Fu et al., 2022). In this study, the gene expression of IL6 and IL10 significantly were up-regulated in fish fed supplemented diet. In line with our findings, increased expression of IL6 and IL10 genes has also been reported in Carassisu auratus gibelio fed with organic acid (Zhang et al., 2019), as well as in Labeo rohita (Sukumaran et al., 2016). The upregulation of IL-6 and IL-10 suggests a balanced immune response induced by dietary supplementation. The upregulation of IL-6 and IL-10 may be indicators of stronger immune power, which helps the fish to resist against pathogens (Mirghaed et al., 2020). This discovery implies that the intake of ginger and/or malic acid may promote the activation of immune cells, thereby enhancing the organism's ability to defend against harmful agents and stressors. The enhanced immune factors caused by malic acid can be explained by the role of acidifiers in increasing the permeability of the intestinal barrier in the gastrointestinal tract (GIT) to nutrients and folic acid. The heightened immune factors observed in the treatment involving malic acid and/or ginger powder indicate that the simultaneous use of malic acid and/or ginger powder leads to a more significant stimulation of innate immune responses compared to the individual use of either of these compounds in rainbow trout.
The evaluation of SOD, CAT, and GPx function and antioxidant related gene (CAT and GPx), being the primary enzymatic antioxidants, serves as a dependable indicator of the antioxidative potential of organisms (Ahmadifar et al., 2019). Our findings imply that the inclusion of malic acid and/or ginger extract in the diet can significantly enhance the antioxidative capacity in rainbow trout by augmenting the activities of SOD, CAT, and GPx and gene expression of CAT and GPx. The previous study documented that herbal extract (Mohammadi et al., 2020; Ahmadifar et al., 2021; Raissy et al., 2022) and organic acid (Sallah-Ud-Din et al., 2017; Asano et al., 2017; Zhang et al., 2020) were able to induce increases in antioxidant enzymes and their related gene. The antioxidant property of organic acid results from the presence of the hydroxyl group, which can easily create a resonance-stabilized phenoxy radical (Yu et al., 2017) and It is also capable of safeguarding biological membranes against lipid peroxidation while simultaneously counteracting peroxyl and alkyl radicals (Maurya and Devasagayam, 2010). Ginger possesses strong antioxidant properties (Si et al., 2018), and studies have indicated the positive impact of ginger on the antioxidant system of fish, as described by Fazelan et al. (2020), Sukumaran et al. (2016), and Ahmadifar et al. (2020). This effect can be attributed to the presence of bioactive compounds in ginger, particularly phenols, tocopherols, and flavonoids (Jelled et al., 2015). Therefore, it can be inferred that ginger extract, in conjunction with other additives that have demonstrated growth-promoting and immunostimulatory properties (Rashidian et al., 2020), can be utilized to enhance the antioxidant capacity, innate immune functions, and overall health of fish.
A
A
Aeromonas hydrophila, a prevalent pathogen in freshwater environments, is responsible for significant economic losses in the aquaculture industry (Anjur et al., 2021). One potential strategy to combat this disease is implementing fish immunization. Nevertheless, the advancement of commercial A. hydrophila vaccines is hindered by the existence of various strains (Mzula et al., 2019). Alternative approaches, such as feed additives, are recommended by different researchers (Anjur et al., 2021). The disease challenges are typically employed to assess the potential of utilizing medicinal herbs (Ahmadifar et al., 2019 a; Ahmadifar et al., 2019 b). The present study indicates that feeding malic acid and/or ginger powder increased the grass carp resistance against A. hydrophila challenge, which might be due to fish immune modulation, as suggested by the aforementioned immunological indices significantly upper in the treated grass carp. In agreement with such outcome dietary administration of herb extract improved the resistance against A. hydrophila in catfish (Pangasius bocourti) (Van Doan et al., 2016).
In conclusion, the administration of malic acid and/or ginger powder has the potential to significantly enhance the growth performance, antioxidant and immune indices of grass carp. By incorporating these substances into their diet, grass carp exhibit a stronger resistance to against A. hydrophila. There are no pharmacokinetic, synergistic, or sensory studies have yet confirmed interactions between these compounds and future studies need to address these mechanistic aspects. The strategic use of malic acid and ginger powder in aquaculture could serve as an effective approach to enhance the growth and health of grass carp, ultimately leading to more sustainable and profitable fish farming practices.
A
Funding:
This research was supported by Islamic Azad University, Azadshahr, Iran.
Data Availability:
All data of this study are included in this article.
Consent for publication:
Not applicable.
Ethics approval:
A
All experiments were performed following the protocol approved by the committee of ethics of the faculty of sciences of the University of Tehran.
A
Author Contribution
Seyyed Ehsan Saberi: Writing, Methodology, and data curation.Afshin Ghelichi: Methodology and Writing original draft and Editing.Reza Akrami: Conceptualization; Methodology, data curation and Editing.Fariborz Ghojoghi: Reviewing and Editing.Sara Jorjani: Editing.
Competing interests:
The authors declare no competing interests.
Electronic Supplementary Material
Below is the link to the electronic supplementary material
References
A
Adineh, H., Naderi, M., Nazer, A., Yousefi, M., & Ahmadifar, E. 2021. Interactive effects of stocking density and dietary supplementation with Nano selenium and garlic extract on growth, feed utilization, digestive enzymes, stress responses, and antioxidant capacity of grass carp, Ctenopharyngodon idella. Journal of the World Aquaculture Society, 52(4), 789–804.
A
Agriculture Organization of the United Nations. Fisheries Department, 2000. The State of World Fisheries and Aquaculture, 2000 (Vol. 3). Food & Agriculture Org.
A
Ahmadifar, E., Dawood, M.A.O., Moghadam, M.S., Sheikhzadeh, N., Hoseinifar, S.H., Musthafa, M.S. 2019 a. Modulation of immune parameters and antioxidant defense in zebrafish (Danio rerio) using dietary apple cider vinegar. Aquaculture. 513, 734412. https://doi.org/10.1016/j.aquaculture.2019.734412.
Ahmadifar, E., Moghadam, M. S., Dawood, M. A., & Hoseinifar, S. H. 2019 b. Lactobacillus fermentum and/or ferulic acid improved the immune responses, antioxidative defence and resistance against Aeromonas hydrophila in common carp (Cyprinus carpio) fingerlings. Fish & shellfish immunology, 94, 916–923.
Ahmadifar, E., Mohammadzadeh, S., Kalhor, N., Yousefi, M., Moghadam, M.S., Naraballobh, W., Ahmadifar, M., Hoseinifar, S.H. and Van Doan, H., 2022. Cornelian cherry (Cornus mas L.) fruit extract improves growth performance, disease resistance, and serum immune-and antioxidant-related gene expression of common carp (Cyprinus carpio). Aquaculture, 558, p.738372.
A
Ahmadifar, E., Pourmohammadi Fallah, H., Yousefi, M., Dawood, M. A., Hoseinifar, S. H., Adineh, H., … Doan, H. V. 2021. The gene regulatory roles of herbal extracts on the growth, immune system, and reproduction of fish. Animals, 11(8), 2167.
Ahmadifar, E., Sadegh, T. H., Dawood, M. A., Dadar, M., & Sheikhzadeh, N. 2020. The effects of dietary Pediococcus pentosaceus on growth performance, hemato-immunological parameters and digestive enzyme activities of common carp (Cyprinus carpio). Aquaculture, 516, 734656.
Ahmadifar, E., Sheikhzadeh, N., Roshanaei, K., Dargahi, N. and Faggio, C., 2019. Can dietary ginger (Zingiber officinale) alter biochemical and immunological parameters and gene expression related to growth, immunity and antioxidant system in zebrafish (Danio rerio). Aquaculture, 507, pp.341–348.
Ahmadifar, E., Yousefi, M., Karimi, M., Fadaei Raieni, R., Dadar, M., Yilmaz, S., Dawood, M.A. and Abdel-Latif, H.M., 2021. Benefits of dietary polyphenols and polyphenol-rich additives to aquatic animal health: an overview. Reviews in Fisheries Science & Aquaculture, 29(4), pp.478–511.
Ali, B.H., Blunden, G., Tanira, M.O. and Nemmar, A., 2008. Some phytochemical, pharmacological and toxicological properties of ginger (Zingiber officinale Roscoe): a review of recent research. Food and chemical Toxicology, 46(2), pp.409–420.
Alizade, H., Ouraji, H., Falahatkar, B. and Efatpanah, I., 2019. Effect of dietary Malic acid on growth performance and body composition of juvenile Siberian sturgeon (Acipenser baerii Brandt, 1869). Iranian Scientific Fisheries Journal, 27(6), pp.1–12.
Anjur, N., Sabran, S.F., Daud, H.M. and Othman, N.Z., 2021. An update on the ornamental fish industry in Malaysia: Aeromonas hydrophila-associated disease and its treatment control. Veterinary World, 14(5), p.1143.
Armobin, K., Ahmadifar, E., Adineh, H., Samani, M.N., Kalhor, N., Yilmaz, S., Hoseinifar, S.H. and Van Doan, H., 2023. Quercetin Application for Common Carp (Cyprinus carpio): I. Effects on Growth Performance, Humoral Immunity, Antioxidant Status, Immune-Related Genes, and Resistance against Heat Stress. Aquaculture Nutrition, 2023.
Asano, T., Matsuzaki, H., Iwata, N., Xuan, M., Kamiuchi, S., Hibino, Y., Sakamoto, T. and Okazaki, M., 2017. Protective effects of ferulic acid against chronic cerebral hypoperfusion-induced swallowing dysfunction in rats. International Journal of Molecular Sciences, 18(3), p.550.
Banaee, M., Sureda, A., Mirvaghefi, A.R. and Rafei, G.R., 2011. Effects of long-term silymarin oral supplementation on the blood biochemical profile of rainbow trout (Oncorhynchus mykiss). Fish physiology and biochemistry, 37, pp.885–896.
Brum, A., Pereira, S.A., Owatari, M.S., Chagas, E.C., Chaves, F.C.M., Mouriño, J.L.P. and Martins, M.L., 2017. Effect of dietary essential oils of clove basil and ginger on Nile tilapia (Oreochromis niloticus) following challenge with Streptococcus agalactiae. Aquaculture, 468, pp.235–243.
Chekani, R., Akrami, R., Ghiasvand, Z., Chitsaz, H., & Jorjani, S. 2021. Effect of dietary dehydrated lemon peel (Citrus limon) supplementation on growth, hemato-immunolological and antioxidant status of rainbow trout (Oncorhynchus mykiss) under exposure to crowding stress. Aquaculture, 539, 736597.
Dawood, M.A., Metwally, A.E.S., El-Sharawy, M.E., Ghozlan, A.M., Abdel-Latif, H.M., Van Doan, H. and Ali, M.A., 2020. The influences of ferulic acid on the growth performance, haemato-immunological responses, and immune-related genes of Nile tilapia (Oreochromis niloticus) exposed to heat stress. Aquaculture, 525, p.735320.
Done, H.Y., Venkatesan, A.K. and Halden, R.U., 2015. Does the recent growth of aquaculture create antibiotic resistance threats different from those associated with land animal production in agriculture. The AAPS journal, 17, pp.513–524.
El-dweny, N.M., El-Bab, A.F.F., Naiel, M.A., 2025. The synergistic role of β-glucan and Bacillus Coagulans on the growth, blood hematological and biochemical indices, intestinal structure, redox status, immune response, and regulation of specific genes in Sparus aurata L. Aquaculture 602, 742316.
Fazelan, Z., Vatnikov, Y.A., Kulikov, E.V., Plushikov, V.G. and Yousefi, M., 2020. Effects of dietary ginger (Zingiber officinale) administration on growth performance and stress, immunological, and antioxidant responses of common carp (Cyprinus carpio) reared under high stocking density. Aquaculture, 518, p.734833.
Ferri-Lagneau, K.F., Moshal, K.S., Grimes, M., Zahora, B., Lv, L., Sang, S. and Leung, T., 2012. Ginger stimulates hematopoiesis via Bmp pathway in zebrafish. PLoS One, 7(6), p.e39327.
Fu, W., Amenyogbe, E., Yang, E., Luo, J., Huang, J.S., Xie, R.T. and Chen, G., 2022. Effects of dietary supplementation of ferulic acid on growth performance, antioxidant ability, non-specific immunity, hepatic morphology and genes expression related to growth and immunity in juvenile hybrid grouper (Epinephelus fuscoguttatus♀× Epinephelus polyphekadion♂). Aquaculture, 552, p.737988.
Fuchs, V.I., Schmidt, J., Slater, M.J., Zentek, J., Buck, B.H. and Steinhagen, D., 2015. The effect of supplementation with polysaccharides, nucleotides, acidifiers and Bacillus strains in fish meal and soy bean based diets on growth performance in juvenile turbot (Scophthalmus maximus). Aquaculture, 437, pp.243–251.
Haghighi, M. and Rohani, M.S., 2013. The effects of powdered ginger (Zingiber officinale) on the haematological and immunological parameters of rainbow trout Oncorhynchus mykiss. Journal of medicinal Plant and Herbal therapy research, 1(1), pp.8–12.
Hashim, M.M., Mingsheng, D., Iqbal, M.F. and Xiaohong, C., 2011. Ginger rhizome as a potential source of milk coagulating cysteine protease. Phytochemistry, 72(6), pp.458–464.
Hassaan, M.S., Mohammady, E.Y., Adnan, A.M., Abd Elnabi, H.E., Ayman, M.F., Soltan, M.A. and El-Haroun, E.R., 2020. Effect of dietary protease at different levels of malic acid on growth, digestive enzymes and haemato-immunological responses of Nile tilapia, fed fish meal free diets. Aquaculture, 522, p.735124.
Hassaan, M.S., Soltan, M.A., Jarmołowicz, S. and Abdo, H.S., 2018. Combined effects of dietary malic acid and Bacillus subtilis on growth, gut microbiota and blood parameters of Nile tilapia (Oreochromis niloticus). Aquaculture Nutrition, 24(1), pp.83–93.
Hoseinifar, S.H., Yousefi, S., Van Doan, H., Ashouri, G., Gioacchini, G., Maradonna, F. and Carnevali, O., 2020. Oxidative stress and antioxidant defense in fish: the implications of probiotic, prebiotic, and synbiotics. Reviews in Fisheries Science & Aquaculture, 29(2), pp.198–217.
Jafarinejad, R., Gharaei, A., Mirdar Harijani, J. 2020. Dietary ginger improve growth performance, blood parameters, antioxidant capacity and gene expression in Cyprinus carpio. Iranian Journal of Fisheries Sciences. Volume 19. No 31237 – 1252 Pp.
Jelled, A., Fernandes, Â., Barros, L., Chahdoura, H., Achour, L., Ferreira, I.C. and Cheikh, H.B., 2015. Chemical and antioxidant parameters of dried forms of ginger rhizomes. Industrial Crops and Products, 77, pp.30–35.
Jesudoss, V.A.S., Santiago, S.V.A., Venkatachalam, K. and Subramanian, P., 2017. Zingerone (ginger extract): Antioxidant potential for efficacy in gastrointestinal and liver disease. In Gastrointestinal tissue (pp. 289–297). Academic Press.
Kim, H.S., Lee, K.W., Jung, H.S., Kim, J., Yun, A., Cho, S.H. and Kwon, M., 2018. Effects of dietary inclusion of yacon, ginger and blueberry on growth, body composition and challenge test of juvenile rockfish (Sebastes schlegeli) against Edwardsiella tarda. Aquaculture Nutrition, 24(3), pp.1048–1055.
Lückstädt, C., 2008. The use of acidifiers in fish nutrition. CABI Reviews, 2008, pp.8-pp.
Maurya, D.K. and Devasagayam, T.P.A., 2010. Antioxidant and prooxidant nature of hydroxycinnamic acid derivatives ferulic and caffeic acids. Food and Chemical Toxicology, 48(12), pp.3369–3373.
Mirghaed, A.T., Hoseini, S.M., Hoseinifar, S.H. and Van Doan, H., 2020. Effects of dietary thyme (Zataria multiflora) extract on antioxidant and immunological responses and immune-related gene expression of rainbow trout (Oncorhynchus mykiss) juveniles. Fish & Shellfish Immunology, 106, pp.502–509.
Mohammadi, G., Rashidian, G., Hoseinifar, S.H., Naserabad, S.S. and Van Doan, H., 2020. Ginger (Zingiber officinale) extract affects growth performance, body composition, haematology, serum and mucosal immune parameters in common carp (Cyprinus carpio). Fish & Shellfish Immunology, 99, pp.267–273.
Mousavi, S., Sheikhzadeh, N., Hamidian, G., Mardani, K., Oushani, A. K., Firouzamandi, M., … Shohreh, P. (2021). Changes in rainbow trout (Oncorhynchus mykiss) growth and mucosal immune parameters after dietary administration of grape (Vitis vinifera) seed extract. Fish Physiology and Biochemistry, 47, 547–563.
Mzula, A., Wambura, P.N., Mdegela, R.H. and Shirima, G.M., 2019. Current state of modern biotechnological-based Aeromonas hydrophila vaccines for aquaculture: a systematic review. BioMed research international, 2019.
A
Nya, E.J. and Austin, B., 2009. Use of dietary ginger, Zingiber officinale Roscoe, as an immunostimulant to control Aeromonas hydrophila infections in rainbow trout, Oncorhynchus mykiss (Walbaum). Journal of fish diseases, 32(11), pp.971–977.
A
Qin, L.U., Xiang, J., Xiong, F., Wang, G., Zou, H., Li, W., Li, M. and Wu, S., 2020. Effects of Bacillus licheniformis on the growth, antioxidant capacity, intestinal barrier and disease resistance of grass carp (Ctenopharyngodon idella). Fish & shellfish immunology, 97, pp.344–350.
Raissy, M., Ghafarifarsani, H., Hoseinifar, S.H., El-Haroun, E.R., Naserabad, S.S. and Van Doan, H., 2022. The effect of dietary combined herbs extracts (oak acorn, coriander, and common mallow) on growth, digestive enzymes, antioxidant and immune response, and resistance against Aeromonas hydrophila infection in common carp, Cyprinus carpio. Aquaculture, 546, p.737287.
Rashidian, G., Bahrami Gorji, S., Farsani, M.N., Prokić, M.D. and Faggio, C., 2020. The oak (Quercus brantii) acorn as a growth promotor for rainbow trout (Oncorhynchus mykiss): growth performance, body composition, liver enzymes activity and blood biochemical parameters. Natural Product Research, 34(17), pp.2413–2423.
Reda, R.M., Mahmoud, R., Selim, K.M. and El-Araby, I.E., 2016. Effects of dietary acidifiers on growth, hematology, immune response and disease resistance of Nile tilapia, Oreochromis niloticus. Fish & shellfish immunology, 50, pp.255–262.
Ricke, S.C., 2003. Perspectives on the use of organic acids and short chain fatty acids as antimicrobials. Poultry science, 82(4), pp.632–639.
Safari, R., Hoseinifar, S.H., Dadar, M. and Van Doan, H., 2021. Enrichment of common carp (Cyprinus carpio) diet with malic acid: Effects on skin mucosal immunity, antioxidant defecne and growth performance. Annals of Animal Science, 21(2), pp.561–573.
Sallah-Ud-Din, R., Farid, M., Saeed, R., Ali, S., Rizwan, M., Tauqeer, H.M. and Bukhari, S.A.H., 2017. Citric acid enhanced the antioxidant defense system and chromium uptake by Lemna minor L. grown in hydroponics under Cr stress. Environmental Science and Pollution Research, 24, pp.17669–17678.
Si, W., Chen, Y.P., Zhang, J., Chen, Z.Y. and Chung, H.Y., 2018. Antioxidant activities of ginger extract and its constituents toward lipids. Food chemistry, 239, pp.1117–1125.
Sniffen, C.J., Ballard, C.S., Carter, M.P., Cotanch, K.W., Dann, H.M., Grant, R.J., Mandebvu, P., Suekawa, M. and Martin, S.A., 2006. Effects of malic acid on microbial efficiency and metabolism in continuous culture of rumen contents and on performance of mid-lactation dairy cows. Animal feed science and technology, 127(1–2), pp.13–31.
Song, X., Zhao, J., Bo, Y., Liu, Z., Wu, K. and Gong, C., 2014. Aeromonas hydrophila induces intestinal inflammation in grass carp (Ctenopharyngodon idella): an experimental model. Aquaculture, 434, pp.171–178.
Sukumaran, V., Park, S.C. and Giri, S.S., 2016. Role of dietary ginger Zingiber officinale in improving growth performances and immune functions of Labeo rohita fingerlings. Fish & shellfish immunology, 57, pp.362–370.
Vahedi, A.A., Akrami, R., Hasanpour, M. nd Chitsaz, H, 2017. Effect of dietary supplementation with ginger (Zingiber officinale) extract on growth, biochemical and hemato-immunological parameters in juvenile beluga (Huso huso). Sustainable Aquaculture and Health Management Journal, 3(1), pp. 26–46
Van Doan, H., Doolgindachbaporn, S. and Suksri, A.J.A.N., 2016. Effect of Lactobacillus plantarum and Jerusalem artichoke (Helianthus tuberosus) on growth performance, immunity and disease resistance of Pangasius catfish (Pangasius bocourti, Sauvage 1880). Aquaculture Nutrition, 22(2), pp.444–456.
Wet, D.L., 2005. Can organic acids effectively replace antibiotics growth promoters in diets for rainbow trout Oncorynchus mykiss raised under sub optimal water temperature. World aquacult. Soc, 3, pp.6–35.
Yilmaz, S., Yilmaz, E., Dawood, M.A., Ringø, E., Ahmadifar, E. and Abdel-Latif, H.M., 2022. Probiotics, prebiotics, and synbiotics used to control vibriosis in fish: A review. Aquaculture, 547,.737514.
Yousefi, M., Ghafarifarsani, H., Hoseinifar, S.H., Rashidian, G. and Van Doan, H., 2021. Effects of dietary marjoram, Origanum majorana extract on growth performance, hematological, antioxidant, humoral and mucosal immune responses, and resistance of common carp, Cyprinus carpio against Aeromonas hydrophila. Fish & Shellfish Immunology, 108, pp.127–133.
Yousefi, M., Ghafarifarsani, H., Raissy, M., Yilmaz, S., Vatnikov, Y.A. and Kulikov, E.V., 2023. Effects of dietary malic acid supplementation on growth performance, antioxidant and immunological parameters, and intestinal gene expressions in rainbow trout, Oncorhynchus mykiss. Aquaculture, 563, p.738864. https://doi.org/10.1016/j.aquaculture.2022.738864.
Yousefi, M., Hoseini, S. M., Vatnikov, Y. A., Kulikov, E. V., & Drukovsky, S. G. (2019). Rosemary leaf powder improved growth performance, immune and antioxidant parameters, and crowding stress responses in common carp (Cyprinus carpio) fingerlings. Aquaculture, 505, 473–480.
Yu, H., Yang, G., Sato, M., Yamaguchi, T., Nakano, T. and Xi, Y., 2017. Antioxidant activities of aqueous extract from Stevia rebaudiana stem waste to inhibit fish oil oxidation and identification of its phenolic compounds. Food chemistry, 232, pp.379–386.
Zhang, L., Zhang, P., Xia, C., Cheng, Y., Guo, X. and Li, Y., 2020. Effects of malic acid and citric acid on growth performance, antioxidant capacity, haematology and immune response of Carassius auratus gibelio. Aquaculture Research, 51(7), pp.2766–2776.
A
Click here to download actual image
B
Click here to download actual image
C
Click here to download actual image
A
Fig. 1
Serum biochemical parameters of grass carp fed with dietary 0.25% malic acid (T1) and 0.2% ginger powder (T2) in separate and in combination (T3) for 56 days in comparison with control group (T0). (A): protein, (B): Triglycerides, (C): Urea.
A
Click here to download actual image
B
Click here to download actual image
C
Click here to download actual image
A
Fig. 2
Serum immune parameters of grass carp fed with dietary 0.25% malic acid (T1) and 0.2% ginger powder (T2) in separate and in combination (T3) for 56 days in comparison with control group (T0). Data are expressed as the mean ± SD. (A): serum lysozyme serum, (B): Total immunoglobulin (C): serum IgM.
A
Click here to download actual image
B
Click here to download actual image
C
Click here to download actual image
A
Fig. 3
Antioxidant enzymes of grass carp fed with dietary 0.25% malic acid (T1) and 0.2% ginger powder (T2) in separate and in combination (T3) for 56 days in comparison with control group (T0). Data are expressed as the mean ± SD. (A): CAT, (B): GPX, (C): SOD
A
Click here to download actual image
Click here to download actual image
Click here to download actual image
Click here to download actual image
Click here to download actual image
B
Click here to download actual image
Click here to download actual image
Click here to download actual image
Click here to download actual image
Click here to download actual image
A
Fig. 4
The transcription of antioxidatnt related genes of grass carp fed with dietary rosemary (T1) and B. subtilis (T2) in separate and in combination (T3) for 56 days in comparison with control group (T0). Data are expressed as the mean ± SD. (A): CAT, (B): GPX.
A
Click here to download actual image
Click here to download actual image
Click here to download actual image
Click here to download actual image
Click here to download actual image
B
Click here to download actual image
Click here to download actual image
Click here to download actual image
Click here to download actual image
Click here to download actual image
A
Fig. 5
The transcription of immune-related genes of grass carp fed with dietary 0.25% malic acid (T1) and 0.2% ginger powder (T2) in separate and in combination (T3) for 56 days in comparison with control group (T0). Data are expressed as the mean ± SD. (A): IL-6, (B): IL-10
A
Fig. 6
Cumulative Survival (%) of grass carp fed with dietary 0.25% malic acid (T1) and 0.2% ginger powder (T2) in separate and in combination (T3) for 56 days in comparison with control group (T0), 14 days post challenge with Aeromonas hydrophila.
Click here to Correct
Ingredients
g kg− 1 diet
Proximate composition4
Percentage
Fish meal1
120
Dry matter
90.13
Soybean protein
90
Crude protein
33.36
Casein
170
Crude lipid
5.82
Gelatin
80
Ash
5.20
Corn starch
50
Energy (kcal/kg)
4044.21
Wheat flour
150
Carbohydrate
45.75
Fish oil
20
  
Soybean oil
20
  
Vitamin premix2
10
  
Mineral premix3
20
  
Cellulose
59.5
  
α-starch
180
  
Monocalcium phosphate
20
  
Choline chloride (50%)
10
  
Ethoxyquin (30%)
0.5
  
1- Pars kilka Co., Mazandaran, Iran (Kilka powder analysis; Protein: 70–72%, Fat: 8–11%, Ash: 11.6%, Moisture: 7–9%). Casein ( Protein) ; Gelatin (Protein)
2- Vitamin premix (per kg of diet): vitamin A, 2000 IU; vitamin B1 (thiamin), 5 mg; vitamin B2 (riboflavin), 5 mg; vitamin B6, 5 mg; vitamin B12, 0.025 mg; vitamin D3, 1200 IU; vitamin E, 63 mg; vitamin K3, 2.5 mg; folic acid, 1.3 mg; biotin, 0.05 mg; pantothenic acid calcium, 20 mg; inositol, 60 mg; ascorbic acid (35%), 110 mg; niacinamide, 25 mg.
3- Mineral premix (per kg of diet): MnSO4, 10 mg; MgSO4, 10 mg; KCl, 95 mg; NaCl, 165 mg; ZnSO4, 20 mg; KI, 1 mg; CuSO4, 12.5 mg; FeSO4, 105 mg; Co, 1.5 mg.4- Assessed based on AOAC.
Total words in MS: 5138
Total words in Title: 22
Total words in Abstract: 254
Total Keyword count: 6
Total Images in MS: 1
Total Tables in MS: 5
Total Reference count: 60