#ID	nr_Symbol	CK5-1	CK5-2	CK5-3	CK6-1	CK6-2	CK6-3	OS5-4	OS5-5	OS5-6	OS6-4	OS6-5	OS6-6	CK5-1_CK5-2_CK5-3_vs_OS5-4_OS5-5_OS5-6_DESeq2_FDR	CK5-1_CK5-2_CK5-3_vs_OS5-4_OS5-5_OS5-6_DESeq2_log2FC	CK5-1_CK5-2_CK5-3_vs_OS5-4_OS5-5_OS5-6_DESeq2_(FDR_0.01_FC_2)_regulated	CK6-1_CK6-2_CK6-3_vs_OS6-4_OS6-5_OS6-6_DESeq2_FDR	CK6-1_CK6-2_CK6-3_vs_OS6-4_OS6-5_OS6-6_DESeq2_log2FC	CK6-1_CK6-2_CK6-3_vs_OS6-4_OS6-5_OS6-6_DESeq2_(FDR_0.01_FC_2)_regulated	COG_class	COG_class_annotation	GO_annotation	KEGG_annotation	KOG_class	KOG_class_annotation	Pfam_annotation	Swissprot_annotation	eggNOG_class	eggNOG_class_annotation	nr_annotation	GO_second_level_annotation	KEGG_pathway_annotation	SSR_SSR_nr	SSR_SSR_type	SSR_SSR	SSR_Size	SSR_SSR_Start	SSR_SSR_End	SSR_FPr1(5'-3')	SSR_Tm_1F	SSR_Size_1F	SSR_RPr1(5'-3')	SSR_Tm_1R	SSR_Size_1R	SSR_PSize1	SSR_PStart1	SSR_PEnd1F	SSR_Pr2(5'-3')	SSR_Tm_2F	SSR_FSize_2F	SSR_RPr2(5'-3')	SSR_Tm_2R	SSR_Size_2R	SSR_PSize2	SSR_PStart2	SSR_PEnd2	SSR_FPr3(5'-3')	SSR_Tm_3	SSR_FSize_3F	SSR_RPr3(5'-3')	SSR_Tm_3R	SSR_Size_3R	SSR_PSize3	SSR_PStart3	SSR_PEnd3
TRINITY_DN10065_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	64.91	23.58	1.23	21.22	22.39	4.71	5.54511867512692e-06	12.0688538156058	up	1.77132282098014e-13	12.1304970675074	up	--	--	Cellular Component: integral component of membrane (GO:0016021);; 	--	--	--	CFEM domain	--	--	--	--	cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN10215_c0_g1	LOC114521991	0.00	0.00	0.03	0.00	0.03	0.00	267.35	150.93	5.68	124.34	98.77	22.52	7.84999792582944e-15	13.2518787620087	up	2.69722292944645e-16	13.3619304265426	up	[G]	Carbohydrate transport and metabolism 	Cellular Component: integral component of membrane (GO:0016021);; Molecular Function: transmembrane transporter activity (GO:0022857);; 	K08150|2.3e-46|pcan:112572972|K08150 MFS transporter, SP family, solute carrier family 2 (myo-inositol transporter), member 13 | (RefSeq) proton myo-inositol cotransporter-like	[R]	General function prediction only 	Sugar (and other) transporter;; Major Facilitator Superfamily;; Sugar (and other) transporter	Membrane transporter D1 OS=Leishmania donovani OX=5661 PE=3 SV=1	U	Intracellular trafficking, secretion, and vesicular transport	proton myo-inositol cotransporter-like [Dendronephthya gigantea]	cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425);; biological process: localization (GO:0051179);; molecular function: transporter activity (GO:0005215)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN1085_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	19.53	17.83	0.93	7.25	4.21	3.00	1.62117825598977e-09	10.3595372465967	up	3.08406967874616e-10	9.7335141752679	up	[CHR]	--	Cellular Component: cytoplasm (GO:0005737);; Molecular Function: formate dehydrogenase (NAD+) activity (GO:0008863);; Cellular Component: formate dehydrogenase complex (GO:0009326);; Molecular Function: oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616);; Biological Process: formate catabolic process (GO:0042183);; Molecular Function: NAD binding (GO:0051287);; 	K00058|1.4e-28|spu:590971|K00058 D-3-phosphoglycerate dehydrogenase / 2-oxoglutarate reductase [EC:1.1.1.95 1.1.1.399] | (RefSeq) D-3-phosphoglycerate dehydrogenase	[C]	Energy production and conversion 	D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain;; D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain	Probable 2-ketogluconate reductase OS=Dictyostelium discoideum OX=44689 GN=tkrA PE=3 SV=1	C	Energy production and conversion	unnamed protein product [Vitrella brassicaformis CCMP3155]	cellular component: cell (GO:0005623);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699);; molecular function: catalytic activity (GO:0003824);; cellular component: macromolecular complex (GO:0032991);; biological process: cellular process (GO:0009987);; molecular function: binding (GO:0005488)	Glycine, serine and threonine metabolism (ko00260);; Cysteine and methionine metabolism (ko00270);; Carbon metabolism (ko01200);; Biosynthesis of amino acids (ko01230)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN10899_c0_g1	LOC110440639	0.00	0.00	0.00	0.00	0.00	0.00	32.27	16.86	2.44	13.35	17.33	5.21	3.47573450676765e-08	9.16325583094641	up	1.83260613607433e-09	9.56626109358595	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02929|5.5e-45|myi:110440639|K02929 large subunit ribosomal protein L44e | (RefSeq) 60S ribosomal protein L44	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L44	Ribosomal protein rpl-36.A OS=Caenorhabditis elegans OX=6239 GN=rpl-36.A PE=3 SV=2	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L44 [Mizuhopecten yessoensis]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN11042_c0_g1	LOC118282213	2.43	74.91	5.11	93.91	5.98	15.10	0.26	0.21	1.41	0.49	0.55	4.41	3.56747981382485e-05	-5.59248308684173	down	0.000503753058851633	-4.03199833355992	down	[QV]	--	Molecular Function: iron ion binding (GO:0005506);; Cellular Component: integral component of membrane (GO:0016021);; Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705);; Molecular Function: heme binding (GO:0020037);; 	K07418|3.8e-186|haw:110376552|K07418 cytochrome P450 family 2 subfamily J [EC:1.14.14.1 1.14.14.73 1.14.14.74 1.14.14.75] | (RefSeq) probable cytochrome P450 303a1	[Q]	Secondary metabolites biosynthesis, transport and catabolism 	Cytochrome P450	Probable cytochrome P450 303a1 OS=Drosophila melanogaster OX=7227 GN=Cyp303a1 PE=2 SV=1	Q	Secondary metabolites biosynthesis, transport and catabolism	probable cytochrome P450 303a1 [Spodoptera frugiperda]	molecular function: binding (GO:0005488);; cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425);; biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699);; molecular function: catalytic activity (GO:0003824)	Arachidonic acid metabolism (ko00590);; Linoleic acid metabolism (ko00591)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN11458_c0_g1	--	0.05	0.02	0.00	0.13	0.04	0.00	13.55	1.81	0.65	0.45	1.68	7.11	2.23005058631537e-07	7.39835537672897	up	1.12275979368989e-06	5.42357756273103	up	--	--	--	--	--	--	--	--	--	--	--	--	--	1	p3	(TAA)7	21	2523	2543	TCGCAAAAGTGACACAAAGTT	58.471	21	CGCACAAGCCGAGCTAACTA	61.600	20	250	2388	2637	TCGCAAAAGTGACACAAAGTT	58.471	21	CGACTGTGTTGGCAATGCT	60.890	19	280	2388	2667	TCGCAAAAGTGACACAAAGTT	58.471	21	CACAAGCCGAGCTAACTACCTT	59.968	22	248	2388	2635
TRINITY_DN11743_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	903.66	275.68	48.04	426.07	505.73	113.87	2.22207375090643e-14	12.4561401058965	up	2.47645373795731e-16	13.2924831664578	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN12070_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	4.98	3.26	0.59	11.11	6.78	1.06	1.44477302447563e-08	9.18238164134827	up	1.04316255343572e-10	11.1599505436324	up	--	--	Molecular Function: protein binding (GO:0005515);; 	--	--	--	BTB/POZ domain;; Protein of unknown function (DUF1349)	--	--	--	hypothetical protein RvY_18491-1 [Ramazzottius varieornatus]	molecular function: binding (GO:0005488)	--	1	p3	(AAG)5	15	2503	2517	GTCGGTGAAGATGAGGAGGA	60.199	20	CGAGGACTTGGTCATGGACT	60.112	20	274	2352	2625	GGTGAAGATGAGGAGGATGC	59.617	20	CGAGGACTTGGTCATGGACT	60.112	20	271	2355	2625	GTGAAGATGAGGAGGATGCC	59.617	20	CGAGGACTTGGTCATGGACT	60.112	20	270	2356	2625
TRINITY_DN12222_c0_g3	--	0.00	0.00	0.00	0.00	0.04	0.00	68.04	31.29	1.39	28.60	22.27	7.25	8.11249435621834e-06	11.8415508738839	up	6.94073729234503e-12	10.9954694357927	up	--	--	Cellular Component: integral component of membrane (GO:0016021);; 	--	--	--	--	--	--	--	--	cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN12246_c0_g1	LOC106134484	140.94	175.25	36.28	228.70	116.82	157.39	6.29	1.15	1.99	5.26	1.45	22.73	7.58635697909002e-12	-5.69370306933571	down	4.91627097755855e-06	-4.00488473350434	down	[HC]	--	Molecular Function: kynurenine 3-monooxygenase activity (GO:0004502);; Biological Process: tryptophan catabolic process (GO:0006569);; Cellular Component: integral component of membrane (GO:0016021);; Biological Process: quinolinate biosynthetic process (GO:0019805);; Cellular Component: mitochondrial membrane (GO:0031966);; Biological Process: 'de novo' NAD biosynthetic process from tryptophan (GO:0034354);; Biological Process: anthranilate metabolic process (GO:0043420);; Molecular Function: FAD binding (GO:0071949);; 	K00486|1.4e-155|prap:110995656|K00486 kynurenine 3-monooxygenase [EC:1.14.13.9] | (RefSeq) kynurenine 3-monooxygenase	[CR]	--	FAD binding domain;; Squalene epoxidase	Kynurenine 3-monooxygenase OS=Anopheles gambiae OX=7165 GN=kh PE=3 SV=2	C	Energy production and conversion	PREDICTED: kynurenine 3-monooxygenase [Amyelois transitella]	biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699);; molecular function: catalytic activity (GO:0003824);; biological process: cellular process (GO:0009987);; cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425);; cellular component: cell (GO:0005623);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464);; molecular function: binding (GO:0005488)	Tryptophan metabolism (ko00380)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN1273_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	76.11	137.18	3.34	80.32	59.27	17.46	3.8839645705757e-07	13.437258002485	up	3.96001358365932e-17	13.6987433737412	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN13533_c0_g1	LOC109466812	0.00	0.00	0.00	0.00	0.00	0.00	15.71	7.26	0.23	1.88	2.66	1.25	5.5628334664608e-05	11.4405861076781	up	2.42149489032692e-11	10.2816161583635	up	--	--	Molecular Function: N-acylsphingosine amidohydrolase activity (GO:0017040);; Biological Process: ceramide catabolic process (GO:0046514);; Molecular Function: ceramidase activity (GO:0102121);; 	K12349|3.9e-140|crg:105347438|K12349 neutral ceramidase [EC:3.5.1.23] | (RefSeq) neutral ceramidase	[T]	Signal transduction mechanisms 	Neutral/alkaline non-lysosomal ceramidase, N-terminal;; Neutral/alkaline non-lysosomal ceramidase, C-terminal	Neutral ceramidase OS=Drosophila pseudoobscura pseudoobscura OX=46245 GN=CDase PE=3 SV=1	T	Signal transduction mechanisms	PREDICTED: neutral ceramidase-like isoform X2 [Branchiostoma belcheri]	molecular function: catalytic activity (GO:0003824);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; biological process: single-organism process (GO:0044699)	Sphingolipid metabolism (ko00600)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN13799_c0_g1	--	0.00	0.00	0.02	0.00	0.07	0.00	17.97	5.92	0.68	8.86	5.02	1.41	3.03043689009708e-08	9.44085011407785	up	1.69492268738466e-08	7.98892219224585	up	[I]	Lipid transport and metabolism 	Molecular Function: molecular_function (GO:0003674);; Molecular Function: catalytic activity (GO:0003824);; Molecular Function: sterol esterase activity (GO:0004771);; Molecular Function: binding (GO:0005488);; Cellular Component: cellular_component (GO:0005575);; Cellular Component: intracellular (GO:0005622);; Cellular Component: obsolete cell (GO:0005623);; Cellular Component: cytoplasm (GO:0005737);; Cellular Component: endoplasmic reticulum (GO:0005783);; Cellular Component: endoplasmic reticulum membrane (GO:0005789);; Biological Process: cellular protein modification process (GO:0006464);; Biological Process: protein dephosphorylation (GO:0006470);; Biological Process: phosphorus metabolic process (GO:0006793);; Biological Process: phosphate-containing compound metabolic process (GO:0006796);; Biological Process: xenobiotic metabolic process (GO:0006805);; Biological Process: nitrogen compound metabolic process (GO:0006807);; Biological Process: cell communication (GO:0007154);; Biological Process: signal transduction (GO:0007165);; Biological Process: cell surface receptor signaling pathway (GO:0007166);; Biological Process: enzyme linked receptor protein signaling pathway (GO:0007167);; Biological Process: transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178);; Biological Process: biological_process (GO:0008150);; Biological Process: metabolic process (GO:0008152);; Biological Process: catabolic process (GO:0009056);; Biological Process: response to xenobiotic stimulus (GO:0009410);; Biological Process: cellular process (GO:0009987);; Cellular Component: endomembrane system (GO:0012505);; Cellular Component: membrane (GO:0016020);; Molecular Function: lipase activity (GO:0016298);; Biological Process: dephosphorylation (GO:0016311);; Molecular Function: hydrolase activity (GO:0016787);; Molecular Function: hydrolase activity, acting on ester bonds (GO:0016788);; Molecular Function: serine hydrolase activity (GO:0017171);; Biological Process: protein metabolic process (GO:0019538);; Biological Process: signaling (GO:0023052);; Cellular Component: organelle subcompartment (GO:0031984);; Biological Process: multicellular organismal process (GO:0032501);; Biological Process: plasma lipoprotein particle clearance (GO:0034381);; Biological Process: low-density lipoprotein particle clearance (GO:0034383);; Biological Process: protein modification process (GO:0036211);; Cellular Component: nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175);; Biological Process: response to chemical (GO:0042221);; Molecular Function: phosphate ion binding (GO:0042301);; Molecular Function: ion binding (GO:0043167);; Molecular Function: anion binding (GO:0043168);; Biological Process: macromolecule metabolic process (GO:0043170);; Cellular Component: organelle (GO:0043226);; Cellular Component: membrane-bounded organelle (GO:0043227);; Cellular Component: intracellular organelle (GO:0043229);; Cellular Component: intracellular membrane-bounded organelle (GO:0043231);; Biological Process: macromolecule modification (GO:0043412);; Biological Process: cellular metabolic process (GO:0044237);; Biological Process: primary metabolic process (GO:0044238);; Biological Process: cellular macromolecule metabolic process (GO:0044260);; Biological Process: cellular protein metabolic process (GO:0044267);; Cellular Component: obsolete organelle part (GO:0044422);; Cellular Component: obsolete intracellular part (GO:0044424);; Cellular Component: obsolete membrane part (GO:0044425);; Cellular Component: obsolete endoplasmic reticulum part (GO:0044432);; Cellular Component: obsolete cytoplasmic part (GO:0044444);; Cellular Component: obsolete intracellular organelle part (GO:0044446);; Cellular Component: obsolete cell part (GO:0044464);; Biological Process: regulation of biological process (GO:0050789);; Biological Process: regulation of cellular process (GO:0050794);; Biological Process: response to stimulus (GO:0050896);; Biological Process: cellular response to stimulus (GO:0051716);; Molecular Function: carboxylic ester hydrolase activity (GO:0052689);; Biological Process: SMAD protein signal transduction (GO:0060395);; Biological Process: biological regulation (GO:0065007);; Biological Process: cellular response to chemical stimulus (GO:0070887);; Biological Process: cellular response to xenobiotic stimulus (GO:0071466);; Biological Process: organic substance metabolic process (GO:0071704);; Biological Process: regulation of plasma lipoprotein particle levels (GO:0097006);; Cellular Component: endoplasmic reticulum subcompartment (GO:0098827);; Biological Process: organonitrogen compound metabolic process (GO:1901564);; 	K14351|2.1e-09|acun:113487884|K14351 arylacetamide deacetylase-like 3/4 [EC:3.1.1.-] | (RefSeq) arylacetamide deacetylase-like 4 isoform X1	--	--	alpha/beta hydrolase fold;; Steryl acetyl hydrolase	--	V	Defense mechanisms	putative acetyl-hydrolase [Planoprotostelium fungivorum]	molecular function: catalytic activity (GO:0003824);; molecular function: binding (GO:0005488);; cellular component: cell (GO:0005623);; cellular component: cell part (GO:0044464);; cellular component: organelle (GO:0043226);; cellular component: membrane (GO:0016020);; cellular component: organelle part (GO:0044422);; cellular component: membrane part (GO:0044425);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; biological process: response to stimulus (GO:0050896);; biological process: signaling (GO:0023052);; biological process: single-organism process (GO:0044699);; biological process: biological regulation (GO:0065007);; biological process: multicellular organismal process (GO:0032501)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN13823_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	28.35	17.40	1.91	7.14	13.83	3.31	7.64806422173797e-09	9.63789275773442	up	3.41613537017149e-09	9.55671354387075	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02870|8.7e-65|bacu:103012292|K02870 large subunit ribosomal protein L12e | (RefSeq) RPL12; ribosomal protein L12	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L11, N-terminal domain;; Ribosomal protein L11, RNA binding domain	60S ribosomal protein L12 OS=Caenorhabditis briggsae OX=6238 GN=rpl-12 PE=3 SV=1	J	Translation, ribosomal structure and biogenesis	ribosomal protein L12, partial [Microcosmus squamiger]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN13840_c0_g1	--	0.30	0.37	0.06	0.00	0.49	0.00	2910.13	1112.48	50.59	1277.09	933.74	251.05	1.51258377392168e-25	12.144891248454	up	4.41254405052922e-18	12.3951259482653	up	--	--	Cellular Component: integral component of membrane (GO:0016021);; 	--	--	--	--	--	--	--	uncharacterized protein LOC111043865 [Nilaparvata lugens]	cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN13863_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	4.97	10.84	1.00	13.69	5.75	4.30	9.92352567121477e-10	10.2264527329395	up	7.57398220461864e-13	11.3709538103532	up	[P]	Inorganic ion transport and metabolism 	Molecular Function: oxidoreductase activity (GO:0016491);; Biological Process: oxidation-reduction process (GO:0055114);; 	K00485|2.7e-18|tad:TRIADDRAFT_29390|K00485 dimethylaniline monooxygenase (N-oxide forming) [EC:1.14.13.8] | (RefSeq) hypothetical protein	[Q]	Secondary metabolites biosynthesis, transport and catabolism 	Pyridine nucleotide-disulphide oxidoreductase;; L-lysine 6-monooxygenase (NADPH-requiring);; Pyridine nucleotide-disulphide oxidoreductase;; Flavin-binding monooxygenase-like;; Pyridine nucleotide-disulphide oxidoreductase;; NAD(P)-binding Rossmann-like domain	--	Q	Secondary metabolites biosynthesis, transport and catabolism	flavin-binding monooxygenase-like protein [Planoprotostelium fungivorum]	biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699);; molecular function: catalytic activity (GO:0003824)	Drug metabolism - cytochrome P450 (ko00982)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN1402_c0_g1	--	0.00	0.00	0.00	0.09	0.04	0.00	218.32	146.72	4.38	71.74	73.98	26.06	1.23445464580596e-08	14.6292338957488	up	9.56403878034909e-24	10.9599286407449	up	--	--	--	--	--	--	LysM domain	--	G	Carbohydrate transport and metabolism	hypothetical protein Y032_0213g2287 [Ancylostoma ceylanicum]	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN15039_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	33.67	19.35	0.76	7.49	12.41	2.50	4.03915354478793e-06	12.115771706502	up	8.99160117967645e-13	11.7333201995921	up	--	--	Biological Process: reproduction (GO:0000003);; Biological Process: nuclear division (GO:0000280);; Molecular Function: RNA cap binding (GO:0000339);; Molecular Function: RNA 7-methylguanosine cap binding (GO:0000340);; Cellular Component: P-body (GO:0000932);; Biological Process: nuclear-transcribed mRNA catabolic process (GO:0000956);; Molecular Function: transcription regulatory region sequence-specific DNA binding (GO:0000976);; Molecular Function: RNA polymerase II transcription regulatory region sequence-specific DNA binding (GO:0000977);; Molecular Function: RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978);; Molecular Function: cis-regulatory region sequence-specific DNA binding (GO:0000987);; Molecular Function: RNA polymerase II complex binding (GO:0000993);; Molecular Function: RNA polymerase II transcription regulatory region sequence-specific DNA binding (GO:0001012);; Molecular Function: core promoter sequence-specific DNA binding (GO:0001047);; Molecular Function: regulatory region nucleic acid binding (GO:0001067);; Molecular Function: basal transcription machinery binding (GO:0001098);; Molecular Function: basal RNA polymerase II transcription machinery binding (GO:0001099);; Biological Process: cell fate determination (GO:0001709);; Biological Process: nematode larval development (GO:0002119);; Biological Process: larval development (GO:0002164);; Biological Process: regulation of immune system process (GO:0002682);; Biological Process: regionalization (GO:0003002);; Biological Process: developmental process involved in reproduction (GO:0003006);; Biological Process: system process (GO:0003008);; Molecular Function: molecular_function (GO:0003674);; Molecular Function: nucleic acid binding (GO:0003676);; Molecular Function: DNA binding (GO:0003677);; Molecular Function: double-stranded DNA binding (GO:0003690);; Molecular Function: RNA binding (GO:0003723);; Molecular Function: double-stranded RNA binding (GO:0003725);; Molecular Function: single-stranded RNA binding (GO:0003727);; Molecular Function: mRNA binding (GO:0003729);; Molecular Function: translation initiation factor activity (GO:0003743);; Molecular Function: catalytic activity (GO:0003824);; Molecular Function: nuclease activity (GO:0004518);; Molecular Function: endonuclease activity (GO:0004519);; Molecular Function: endoribonuclease activity (GO:0004521);; Molecular Function: ribonuclease activity (GO:0004540);; Molecular Function: binding (GO:0005488);; Molecular Function: protein binding (GO:0005515);; Cellular Component: cellular_component (GO:0005575);; Cellular Component: extracellular region (GO:0005576);; Cellular Component: extracellular space (GO:0005615);; Cellular Component: intracellular (GO:0005622);; Cellular Component: obsolete cell (GO:0005623);; Cellular Component: nucleus (GO:0005634);; Cellular Component: nucleoplasm (GO:0005654);; Cellular Component: cytoplasm (GO:0005737);; Cellular Component: mitochondrion (GO:0005739);; Cellular Component: cytosol (GO:0005829);; Cellular Component: polysome (GO:0005844);; Cellular Component: mRNA cap binding complex (GO:0005845);; Biological Process: nucleobase-containing compound metabolic process (GO:0006139);; Biological Process: chromatin organization (GO:0006325);; Biological Process: chromatin silencing (GO:0006342);; Biological Process: regulation of transcription, DNA-templated (GO:0006355);; Biological Process: regulation of transcription by RNA polymerase II (GO:0006357);; Biological Process: mRNA cleavage (GO:0006379);; Biological Process: RNA processing (GO:0006396);; Biological Process: RNA catabolic process (GO:0006401);; Biological Process: mRNA catabolic process (GO:0006402);; Biological Process: translation (GO:0006412);; Biological Process: translational initiation (GO:0006413);; Biological Process: regulation of translation (GO:0006417);; Biological Process: regulation of translational initiation (GO:0006446);; Biological Process: peptide metabolic process (GO:0006518);; Biological Process: cellular aromatic compound metabolic process (GO:0006725);; Biological Process: nitrogen compound metabolic process (GO:0006807);; Biological Process: organelle organization (GO:0006996);; Biological Process: cell cycle (GO:0007049);; Biological Process: chromosome segregation (GO:0007059);; Biological Process: meiosis I (GO:0007127);; Biological Process: synapsis (GO:0007129);; Biological Process: synaptonemal complex assembly (GO:0007130);; Biological Process: male meiotic nuclear division (GO:0007140);; Biological Process: cell communication (GO:0007154);; Biological Process: signal transduction (GO:0007165);; Biological Process: cell surface receptor signaling pathway (GO:0007166);; Biological Process: Wnt signaling pathway, calcium modulating pathway (GO:0007223);; Biological Process: cell-cell signaling (GO:0007267);; Biological Process: multicellular organism development (GO:0007275);; Biological Process: gamete generation (GO:0007276);; Biological Process: germ cell development (GO:0007281);; Biological Process: female gamete generation (GO:0007292);; Biological Process: germarium-derived egg chamber formation (GO:0007293);; Biological Process: germarium-derived oocyte fate determination (GO:0007294);; Biological Process: blastoderm segmentation (GO:0007350);; Biological Process: periodic partitioning (GO:0007365);; Biological Process: segment polarity determination (GO:0007367);; Biological Process: pattern specification process (GO:0007389);; Biological Process: nervous system development (GO:0007399);; Biological Process: synapse assembly (GO:0007416);; Biological Process: sex differentiation (GO:0007548);; Biological Process: behavior (GO:0007610);; Biological Process: learning or memory (GO:0007611);; Biological Process: learning (GO:0007612);; Molecular Function: protein C-terminus binding (GO:0008022);; Molecular Function: translation factor activity, RNA binding (GO:0008135);; Biological Process: biological_process (GO:0008150);; Biological Process: metabolic process (GO:0008152);; Biological Process: cell population proliferation (GO:0008283);; Biological Process: gonad development (GO:0008406);; Biological Process: male gonad development (GO:0008584);; Biological Process: catabolic process (GO:0009056);; Biological Process: macromolecule catabolic process (GO:0009057);; Biological Process: biosynthetic process (GO:0009058);; Biological Process: macromolecule biosynthetic process (GO:0009059);; Biological Process: anatomical structure morphogenesis (GO:0009653);; Biological Process: embryo development (GO:0009790);; Biological Process: post-embryonic development (GO:0009791);; Biological Process: embryo development ending in birth or egg hatching (GO:0009792);; Biological Process: embryonic pattern specification (GO:0009880);; Biological Process: regulation of biosynthetic process (GO:0009889);; Biological Process: negative regulation of biosynthetic process (GO:0009890);; Biological Process: positive regulation of biosynthetic process (GO:0009891);; Biological Process: negative regulation of metabolic process (GO:0009892);; Biological Process: positive regulation of metabolic process (GO:0009893);; Biological Process: regulation of catabolic process (GO:0009894);; Biological Process: positive regulation of catabolic process (GO:0009896);; Biological Process: regulation of signal transduction (GO:0009966);; Biological Process: positive regulation of signal transduction (GO:0009967);; Biological Process: cellular process (GO:0009987);; Biological Process: oocyte differentiation (GO:0009994);; Biological Process: response to organic substance (GO:0010033);; Biological Process: regulation of cell fate commitment (GO:0010453);; Biological Process: gene expression (GO:0010467);; Biological Process: regulation of gene expression (GO:0010468);; Biological Process: RNA secondary structure unwinding (GO:0010501);; Biological Process: regulation of macromolecule biosynthetic process (GO:0010556);; Biological Process: positive regulation of macromolecule biosynthetic process (GO:0010557);; Biological Process: negative regulation of macromolecule biosynthetic process (GO:0010558);; Biological Process: miRNA metabolic process (GO:0010586);; Biological Process: positive regulation of macromolecule metabolic process (GO:0010604);; Biological Process: negative regulation of macromolecule metabolic process (GO:0010605);; Biological Process: posttranscriptional regulation of gene expression (GO:0010608);; Biological Process: positive regulation of gene expression (GO:0010628);; Biological Process: negative regulation of gene expression (GO:0010629);; Biological Process: regulation of cell communication (GO:0010646);; Biological Process: positive regulation of cell communication (GO:0010647);; Biological Process: regulation of cell death (GO:0010941);; Biological Process: response to organic cyclic compound (GO:0014070);; Biological Process: cellular component organization (GO:0016043);; Biological Process: Wnt signaling pathway (GO:0016055);; Biological Process: RNA metabolic process (GO:0016070);; Biological Process: mRNA metabolic process (GO:0016071);; Biological Process: RNA interference (GO:0016246);; Biological Process: posttranscriptional gene silencing (GO:0016441);; Cellular Component: RISC complex (GO:0016442);; Biological Process: gene silencing (GO:0016458);; Biological Process: negative regulation of angiogenesis (GO:0016525);; Cellular Component: nuclear body (GO:0016604);; Molecular Function: hydrolase activity (GO:0016787);; Molecular Function: hydrolase activity, acting on ester bonds (GO:0016788);; Molecular Function: endoribonuclease activity, producing 5'-phosphomonoesters (GO:0016891);; Molecular Function: endoribonuclease activity, producing 3'-phosphomonoesters (GO:0016892);; Molecular Function: endonuclease activity, active with either ribo- or deoxyribonucleic acids and producing 5'-phosphomonoesters (GO:0016893);; Molecular Function: endonuclease activity, active with either ribo- or deoxyribonucleic acids and producing 3'-phosphomonoesters (GO:0016894);; Biological Process: negative regulation of translation (GO:0017148);; Biological Process: regulation of nucleobase-containing compound metabolic process (GO:0019219);; Biological Process: regulation of metabolic process (GO:0019222);; Biological Process: aromatic compound catabolic process (GO:0019439);; Biological Process: protein metabolic process (GO:0019538);; Biological Process: stem cell population maintenance (GO:0019827);; Molecular Function: enzyme binding (GO:0019899);; Biological Process: sexual reproduction (GO:0019953);; Biological Process: cell cycle process (GO:0022402);; Biological Process: cellular process involved in reproduction in multicellular organism (GO:0022412);; Biological Process: reproductive process (GO:0022414);; Biological Process: regulation of anatomical structure morphogenesis (GO:0022603);; Biological Process: regulation of cell morphogenesis (GO:0022604);; Biological Process: cellular component assembly (GO:0022607);; Biological Process: ribonucleoprotein complex biogenesis (GO:0022613);; Biological Process: ribonucleoprotein complex assembly (GO:0022618);; Biological Process: regulation of signaling (GO:0023051);; Biological Process: signaling (GO:0023052);; Biological Process: positive regulation of signaling (GO:0023056);; Cellular Component: cell junction (GO:0030054);; Biological Process: cell differentiation (GO:0030154);; Biological Process: regulation of cell migration (GO:0030334);; Biological Process: positive regulation of cell migration (GO:0030335);; Biological Process: production of siRNA involved in RNA interference (GO:0030422);; Biological Process: targeting of mRNA for destruction involved in RNA interference (GO:0030423);; Cellular Component: dendrite (GO:0030425);; Biological Process: germarium-derived oocyte differentiation (GO:0030706);; Biological Process: oocyte fate determination (GO:0030716);; Biological Process: germ-line stem cell population maintenance (GO:0030718);; Biological Process: germarium-derived female germ-line cyst formation (GO:0030727);; Biological Process: gene silencing by RNA (GO:0031047);; Biological Process: dsRNA processing (GO:0031050);; Biological Process: pre-miRNA processing (GO:0031054);; Biological Process: regulation of cellular metabolic process (GO:0031323);; Biological Process: negative regulation of cellular metabolic process (GO:0031324);; Biological Process: positive regulation of cellular metabolic process (GO:0031325);; Biological Process: regulation of cellular biosynthetic process (GO:0031326);; Biological Process: negative regulation of cellular biosynthetic process (GO:0031327);; Biological Process: positive regulation of cellular biosynthetic process (GO:0031328);; Biological Process: regulation of cellular catabolic process (GO:0031329);; Biological Process: positive regulation of cellular catabolic process (GO:0031331);; Cellular Component: RNAi effector complex (GO:0031332);; Biological Process: regulation of nervous system process (GO:0031644);; Cellular Component: membrane-enclosed lumen (GO:0031974);; Cellular Component: nuclear lumen (GO:0031981);; Cellular Component: vesicle (GO:0031982);; Biological Process: regulation of cellular protein metabolic process (GO:0032268);; Biological Process: negative regulation of cellular protein metabolic process (GO:0032269);; Biological Process: multicellular organismal process (GO:0032501);; Biological Process: developmental process (GO:0032502);; Biological Process: multicellular organism reproduction (GO:0032504);; Biological Process: regulation of localization (GO:0032879);; Cellular Component: protein-containing complex (GO:0032991);; Biological Process: regulation of cellular amide metabolic process (GO:0034248);; Biological Process: negative regulation of cellular amide metabolic process (GO:0034249);; Biological Process: ncRNA processing (GO:0034470);; Cellular Component: RNA cap binding complex (GO:0034518);; Biological Process: cellular protein-containing complex assembly (GO:0034622);; Biological Process: cellular nitrogen compound metabolic process (GO:0034641);; Biological Process: cellular macromolecule biosynthetic process (GO:0034645);; Biological Process: nucleobase-containing compound catabolic process (GO:0034655);; Biological Process: ncRNA metabolic process (GO:0034660);; Cellular Component: RISC complex (GO:0035068);; Biological Process: siRNA loading onto RISC involved in RNA interference (GO:0035087);; Biological Process: post-transcriptional gene silencing by RNA (GO:0035194);; Biological Process: gene silencing by miRNA (GO:0035195);; Biological Process: production of miRNAs involved in gene silencing by miRNA (GO:0035196);; Molecular Function: siRNA binding (GO:0035197);; Molecular Function: miRNA binding (GO:0035198);; Biological Process: miRNA mediated inhibition of translation (GO:0035278);; Biological Process: mRNA cleavage involved in gene silencing by miRNA (GO:0035279);; Biological Process: miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280);; Biological Process: segmentation (GO:0035282);; Biological Process: non-canonical Wnt signaling pathway (GO:0035567);; Cellular Component: ribonucleoprotein granule (GO:0035770);; Biological Process: female germ-line stem cell population maintenance (GO:0036099);; Cellular Component: cytoplasmic ribonucleoprotein granule (GO:0036464);; Cellular Component: somatodendritic compartment (GO:0036477);; Biological Process: regulation of locomotion (GO:0040012);; Biological Process: positive regulation of locomotion (GO:0040017);; Biological Process: vulval development (GO:0040025);; Biological Process: regulation of gene expression, epigenetic (GO:0040029);; Biological Process: negative regulation of translation, ncRNA-mediated (GO:0040033);; Biological Process: regulation of development, heterochronic (GO:0040034);; Biological Process: hermaphrodite genitalia development (GO:0040035);; Biological Process: response to chemical (GO:0042221);; Biological Process: regulation of cell fate specification (GO:0042659);; Biological Process: regulation of apoptotic process (GO:0042981);; Cellular Component: cell projection (GO:0042995);; Cellular Component: neuron projection (GO:0043005);; Biological Process: peptide biosynthetic process (GO:0043043);; Biological Process: negative regulation of apoptotic process (GO:0043066);; Biological Process: regulation of programmed cell death (GO:0043067);; Biological Process: negative regulation of programmed cell death (GO:0043069);; Biological Process: macromolecule metabolic process (GO:0043170);; Molecular Function: RNA polymerase core enzyme binding (GO:0043175);; Cellular Component: organelle (GO:0043226);; Cellular Component: membrane-bounded organelle (GO:0043227);; Cellular Component: non-membrane-bounded organelle (GO:0043228);; Cellular Component: intracellular organelle (GO:0043229);; Cellular Component: extracellular organelle (GO:0043230);; Cellular Component: intracellular membrane-bounded organelle (GO:0043231);; Cellular Component: intracellular non-membrane-bounded organelle (GO:0043232);; Cellular Component: organelle lumen (GO:0043233);; Biological Process: response to dsRNA (GO:0043331);; Molecular Function: sequence-specific DNA binding (GO:0043565);; Biological Process: cellular amide metabolic process (GO:0043603);; Biological Process: amide biosynthetic process (GO:0043604);; Biological Process: regulation of multi-organism process (GO:0043900);; Biological Process: positive regulation of multi-organism process (GO:0043902);; Biological Process: protein-containing complex subunit organization (GO:0043933);; Biological Process: regulation of system process (GO:0044057);; Biological Process: cellular component biogenesis (GO:0044085);; Molecular Function: transcription regulatory region sequence-specific DNA binding (GO:0044212);; Biological Process: cellular metabolic process (GO:0044237);; Biological Process: primary metabolic process (GO:0044238);; Biological Process: cellular catabolic process (GO:0044248);; Biological Process: cellular biosynthetic process (GO:0044249);; Biological Process: cellular macromolecule metabolic process (GO:0044260);; Biological Process: cellular macromolecule catabolic process (GO:0044265);; Biological Process: cellular protein metabolic process (GO:0044267);; Biological Process: cellular nitrogen compound catabolic process (GO:0044270);; Biological Process: cellular nitrogen compound biosynthetic process (GO:0044271);; Cellular Component: obsolete extracellular region part (GO:0044421);; Cellular Component: obsolete organelle part (GO:0044422);; Cellular Component: obsolete intracellular part (GO:0044424);; Cellular Component: obsolete nuclear part (GO:0044428);; Cellular Component: obsolete cytoplasmic part (GO:0044444);; Cellular Component: obsolete intracellular organelle part (GO:0044446);; Cellular Component: obsolete nucleoplasm part (GO:0044451);; Cellular Component: obsolete cell projection part (GO:0044463);; Cellular Component: obsolete cell part (GO:0044464);; Biological Process: multi-organism reproductive process (GO:0044703);; Molecular Function: protein-containing complex binding (GO:0044877);; Biological Process: meiotic chromosome segregation (GO:0045132);; Biological Process: development of primary sexual characteristics (GO:0045137);; Biological Process: homologous chromosome segregation (GO:0045143);; Biological Process: cell fate commitment (GO:0045165);; Biological Process: regulation of cell differentiation (GO:0045595);; Biological Process: regulation of myeloid cell differentiation (GO:0045637);; Biological Process: regulation of megakaryocyte differentiation (GO:0045652);; Biological Process: regulation of angiogenesis (GO:0045765);; Biological Process: positive regulation of angiogenesis (GO:0045766);; Biological Process: negative regulation of gene expression, epigenetic (GO:0045814);; Biological Process: negative regulation of transcription, DNA-templated (GO:0045892);; Biological Process: positive regulation of transcription, DNA-templated (GO:0045893);; Biological Process: negative regulation of nucleobase-containing compound metabolic process (GO:0045934);; Biological Process: positive regulation of nucleobase-containing compound metabolic process (GO:0045935);; Biological Process: positive regulation of transcription by RNA polymerase II (GO:0045944);; Biological Process: negative regulation of translational initiation (GO:0045947);; Biological Process: regulation of translation, ncRNA-mediated (GO:0045974);; Biological Process: heterocycle metabolic process (GO:0046483);; Biological Process: development of primary male sexual characteristics (GO:0046546);; Biological Process: male sex differentiation (GO:0046661);; Biological Process: heterocycle catabolic process (GO:0046700);; Biological Process: nonassociative learning (GO:0046958);; Biological Process: habituation (GO:0046959);; Biological Process: germ-line cyst formation (GO:0048134);; Biological Process: female germ-line cyst formation (GO:0048135);; Biological Process: male gamete generation (GO:0048232);; Biological Process: organelle fission (GO:0048285);; Biological Process: cell development (GO:0048468);; Cellular Component: perinuclear region of cytoplasm (GO:0048471);; Biological Process: oogenesis (GO:0048477);; Biological Process: animal organ development (GO:0048513);; Biological Process: positive regulation of biological process (GO:0048518);; Biological Process: negative regulation of biological process (GO:0048519);; Biological Process: positive regulation of cellular process (GO:0048522);; Biological Process: negative regulation of cellular process (GO:0048523);; Biological Process: post-embryonic animal organ development (GO:0048569);; Biological Process: regulation of response to stimulus (GO:0048583);; Biological Process: positive regulation of response to stimulus (GO:0048584);; Biological Process: reproductive structure development (GO:0048608);; Biological Process: multicellular organismal reproductive process (GO:0048609);; Biological Process: anatomical structure formation involved in morphogenesis (GO:0048646);; Biological Process: system development (GO:0048731);; Biological Process: genitalia development (GO:0048806);; Biological Process: anatomical structure development (GO:0048856);; Biological Process: cellular developmental process (GO:0048869);; Biological Process: regulation of biological process (GO:0050789);; Biological Process: regulation of developmental process (GO:0050793);; Biological Process: regulation of cellular process (GO:0050794);; Biological Process: regulation of behavior (GO:0050795);; Biological Process: synapse organization (GO:0050808);; Biological Process: nervous system process (GO:0050877);; Biological Process: cognition (GO:0050890);; Biological Process: response to stimulus (GO:0050896);; Biological Process: negative regulation of developmental process (GO:0051093);; Biological Process: positive regulation of developmental process (GO:0051094);; Biological Process: regulation of cellular component organization (GO:0051128);; Biological Process: regulation of nitrogen compound metabolic process (GO:0051171);; Biological Process: negative regulation of nitrogen compound metabolic process (GO:0051172);; Biological Process: positive regulation of nitrogen compound metabolic process (GO:0051173);; Biological Process: regulation of multicellular organismal process (GO:0051239);; Biological Process: positive regulation of multicellular organismal process (GO:0051240);; Biological Process: negative regulation of multicellular organismal process (GO:0051241);; Biological Process: regulation of protein metabolic process (GO:0051246);; Biological Process: negative regulation of protein metabolic process (GO:0051248);; Biological Process: regulation of RNA metabolic process (GO:0051252);; Biological Process: negative regulation of RNA metabolic process (GO:0051253);; Biological Process: positive regulation of RNA metabolic process (GO:0051254);; Biological Process: regulation of cellular component movement (GO:0051270);; Biological Process: positive regulation of cellular component movement (GO:0051272);; Biological Process: chromosome organization (GO:0051276);; Biological Process: meiotic cell cycle (GO:0051321);; Biological Process: multi-organism process (GO:0051704);; Biological Process: cellular response to stimulus (GO:0051716);; Biological Process: regulation of posttranscriptional gene silencing (GO:0060147);; Biological Process: positive regulation of posttranscriptional gene silencing (GO:0060148);; Biological Process: regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060211);; Biological Process: positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213);; Biological Process: regulation of macromolecule metabolic process (GO:0060255);; Biological Process: negative regulation of cell death (GO:0060548);; Biological Process: regulation of gene silencing by miRNA (GO:0060964);; Biological Process: regulation of gene silencing by RNA (GO:0060966);; Biological Process: regulation of gene silencing (GO:0060968);; Biological Process: regulation of mRNA catabolic process (GO:0061013);; Biological Process: positive regulation of mRNA catabolic process (GO:0061014);; Biological Process: reproductive system development (GO:0061458);; Molecular Function: regulatory RNA binding (GO:0061980);; Biological Process: meiosis I cell cycle process (GO:0061982);; Biological Process: protein-containing complex assembly (GO:0065003);; Biological Process: biological regulation (GO:0065007);; Cellular Component: intracellular organelle lumen (GO:0070013);; Cellular Component: extracellular exosome (GO:0070062);; Molecular Function: RNA polymerase binding (GO:0070063);; Biological Process: chromosome organization involved in meiotic cell cycle (GO:0070192);; Biological Process: synaptonemal complex organization (GO:0070193);; Molecular Function: endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551);; Cellular Component: RISC-loading complex (GO:0070578);; Biological Process: cellular response to chemical stimulus (GO:0070887);; Biological Process: production of small RNA involved in gene silencing by RNA (GO:0070918);; Biological Process: small RNA loading onto RISC (GO:0070922);; Biological Process: cellular response to organic substance (GO:0071310);; Biological Process: cellular response to dsRNA (GO:0071359);; Biological Process: cellular response to organic cyclic compound (GO:0071407);; Biological Process: organic substance metabolic process (GO:0071704);; Biological Process: ribonucleoprotein complex subunit organization (GO:0071826);; Biological Process: cellular component organization or biogenesis (GO:0071840);; Biological Process: regulation of primary metabolic process (GO:0080090);; Biological Process: nucleic acid metabolic process (GO:0090304);; Biological Process: nucleic acid phosphodiester bond hydrolysis (GO:0090305);; Biological Process: regulation of olfactory learning (GO:0090328);; Biological Process: RNA phosphodiester bond hydrolysis (GO:0090501);; Biological Process: RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502);; Molecular Function: endoribonuclease activity, cleaving miRNA-paired mRNA (GO:0090624);; Biological Process: mRNA cleavage involved in gene silencing by siRNA (GO:0090625);; Molecular Function: organic cyclic compound binding (GO:0097159);; Cellular Component: dendritic tree (GO:0097447);; Cellular Component: obsolete neuron part (GO:0097458);; Biological Process: maintenance of cell number (GO:0098727);; Biological Process: mRNA cleavage involved in gene silencing (GO:0098795);; Molecular Function: mRNA cap binding (GO:0098808);; Biological Process: nuclear chromosome segregation (GO:0098813);; Cellular Component: plasma membrane bounded cell projection (GO:0120025);; Cellular Component: obsolete plasma membrane bounded cell projection part (GO:0120038);; Biological Process: meiotic nuclear division (GO:0140013);; Molecular Function: catalytic activity, acting on RNA (GO:0140098);; Biological Process: cell-cell signaling by wnt (GO:0198738);; Biological Process: regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900151);; Biological Process: positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153);; Biological Process: regulation of trophoblast cell migration (GO:1901163);; Biological Process: positive regulation of trophoblast cell migration (GO:1901165);; Biological Process: regulation of NIK/NF-kappaB signaling (GO:1901222);; Biological Process: positive regulation of NIK/NF-kappaB signaling (GO:1901224);; Biological Process: regulation of vasculature development (GO:1901342);; Biological Process: negative regulation of vasculature development (GO:1901343);; Biological Process: organic cyclic compound metabolic process (GO:1901360);; Biological Process: organic cyclic compound catabolic process (GO:1901361);; Molecular Function: heterocyclic compound binding (GO:1901363);; Biological Process: organonitrogen compound metabolic process (GO:1901564);; Biological Process: organonitrogen compound biosynthetic process (GO:1901566);; Biological Process: organic substance catabolic process (GO:1901575);; Biological Process: organic substance biosynthetic process (GO:1901576);; Biological Process: response to nitrogen compound (GO:1901698);; Biological Process: cellular response to nitrogen compound (GO:1901699);; Cellular Component: catalytic complex (GO:1902494);; Biological Process: regulation of intracellular signal transduction (GO:1902531);; Biological Process: positive regulation of intracellular signal transduction (GO:1902533);; Cellular Component: endoribonuclease complex (GO:1902555);; Biological Process: negative regulation of RNA biosynthetic process (GO:1902679);; Biological Process: positive regulation of RNA biosynthetic process (GO:1902680);; Biological Process: meiotic cell cycle process (GO:1903046);; Biological Process: regulation of mRNA metabolic process (GO:1903311);; Biological Process: positive regulation of mRNA metabolic process (GO:1903313);; Biological Process: regulation of nucleic acid-templated transcription (GO:1903506);; Biological Process: negative regulation of nucleic acid-templated transcription (GO:1903507);; Biological Process: positive regulation of nucleic acid-templated transcription (GO:1903508);; Cellular Component: extracellular vesicle (GO:1903561);; Biological Process: regulation of hemopoiesis (GO:1903706);; Biological Process: positive regulation of vasculature development (GO:1904018);; Biological Process: cell surface receptor signaling pathway involved in cell-cell signaling (GO:1905114);; Cellular Component: endonuclease complex (GO:1905348);; Biological Process: regulation of miRNA mediated inhibition of translation (GO:1905616);; Biological Process: positive regulation of miRNA mediated inhibition of translation (GO:1905618);; Molecular Function: sequence-specific double-stranded DNA binding (GO:1990837);; Cellular Component: ribonucleoprotein complex (GO:1990904);; Biological Process: regulation of multicellular organismal development (GO:2000026);; Biological Process: regulation of cellular macromolecule biosynthetic process (GO:2000112);; Biological Process: negative regulation of cellular macromolecule biosynthetic process (GO:2000113);; Biological Process: regulation of cell motility (GO:2000145);; Biological Process: positive regulation of cell motility (GO:2000147);; Biological Process: negative regulation of blood vessel morphogenesis (GO:2000181);; Biological Process: regulation of reproductive process (GO:2000241);; Biological Process: positive regulation of reproductive process (GO:2000243);; Biological Process: positive regulation of gene silencing by miRNA (GO:2000637);; Biological Process: regulation of RNA biosynthetic process (GO:2001141);; 	K11593|1.7e-81|egl:EGR_06606|K11593 eukaryotic translation initiation factor 2C | (RefSeq) Protein argonaute-2	[J]	Translation, ribosomal structure and biogenesis 	Piwi domain;; N-terminal domain of argonaute;; Argonaute linker 1 domain;; PAZ domain;; Argonaute linker 2 domain;; Mid domain of argonaute	Putative protein tag-76 OS=Caenorhabditis elegans OX=6239 GN=tag-76 PE=4 SV=2	J	Translation, ribosomal structure and biogenesis	unnamed protein product [Taenia asiatica]	biological process: reproduction (GO:0000003);; biological process: cellular process (GO:0009987);; biological process: cellular component organization or biogenesis (GO:0071840);; molecular function: binding (GO:0005488);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: biological regulation (GO:0065007);; biological process: developmental process (GO:0032502);; biological process: single-organism process (GO:0044699);; biological process: multicellular organismal process (GO:0032501);; biological process: reproductive process (GO:0022414);; molecular function: catalytic activity (GO:0003824);; cellular component: extracellular region (GO:0005576);; cellular component: extracellular region part (GO:0044421);; cellular component: membrane-enclosed lumen (GO:0031974);; cellular component: organelle part (GO:0044422);; biological process: multi-organism process (GO:0051704);; biological process: signaling (GO:0023052);; biological process: response to stimulus (GO:0050896);; biological process: behavior (GO:0007610);; cellular component: cell junction (GO:0030054)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN1513_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	33.62	23.98	2.08	21.52	29.75	6.50	6.78420039976031e-10	10.3495081909774	up	8.25622223782169e-12	11.158470859169	up	--	--	Biological Process: ribosomal small subunit assembly (GO:0000028);; Molecular Function: tRNA binding (GO:0000049);; Biological Process: nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184);; Biological Process: nuclear-transcribed mRNA catabolic process (GO:0000956);; Molecular Function: molecular_function (GO:0003674);; Molecular Function: nucleic acid binding (GO:0003676);; Molecular Function: RNA binding (GO:0003723);; Molecular Function: structural constituent of ribosome (GO:0003735);; Molecular Function: structural molecule activity (GO:0005198);; Molecular Function: binding (GO:0005488);; Molecular Function: protein binding (GO:0005515);; Cellular Component: cellular_component (GO:0005575);; Cellular Component: intracellular (GO:0005622);; Cellular Component: obsolete cell (GO:0005623);; Cellular Component: nucleus (GO:0005634);; Cellular Component: nucleoplasm (GO:0005654);; Cellular Component: nucleolus (GO:0005730);; Cellular Component: cytoplasm (GO:0005737);; Cellular Component: cytosol (GO:0005829);; Cellular Component: ribosome (GO:0005840);; Biological Process: nucleobase-containing compound metabolic process (GO:0006139);; Biological Process: RNA catabolic process (GO:0006401);; Biological Process: mRNA catabolic process (GO:0006402);; Biological Process: translation (GO:0006412);; Biological Process: translational initiation (GO:0006413);; Biological Process: peptide metabolic process (GO:0006518);; Biological Process: protein targeting (GO:0006605);; Biological Process: protein targeting to membrane (GO:0006612);; Biological Process: cotranslational protein targeting to membrane (GO:0006613);; Biological Process: SRP-dependent cotranslational protein targeting to membrane (GO:0006614);; Biological Process: cellular aromatic compound metabolic process (GO:0006725);; Biological Process: nitrogen compound metabolic process (GO:0006807);; Biological Process: transport (GO:0006810);; Biological Process: intracellular protein transport (GO:0006886);; Biological Process: organelle organization (GO:0006996);; Biological Process: multicellular organism development (GO:0007275);; Biological Process: aging (GO:0007568);; Biological Process: protein localization (GO:0008104);; Biological Process: biological_process (GO:0008150);; Biological Process: metabolic process (GO:0008152);; Biological Process: determination of adult lifespan (GO:0008340);; Biological Process: catabolic process (GO:0009056);; Biological Process: macromolecule catabolic process (GO:0009057);; Biological Process: biosynthetic process (GO:0009058);; Biological Process: macromolecule biosynthetic process (GO:0009059);; Biological Process: negative regulation of metabolic process (GO:0009892);; Biological Process: cellular process (GO:0009987);; Biological Process: multicellular organism aging (GO:0010259);; Biological Process: gene expression (GO:0010467);; Biological Process: regulation of gene expression (GO:0010468);; Biological Process: negative regulation of macromolecule metabolic process (GO:0010605);; Biological Process: negative regulation of gene expression (GO:0010629);; Biological Process: protein transport (GO:0015031);; Biological Process: peptide transport (GO:0015833);; Cellular Component: small ribosomal subunit (GO:0015935);; Biological Process: cellular component organization (GO:0016043);; Biological Process: RNA metabolic process (GO:0016070);; Biological Process: mRNA metabolic process (GO:0016071);; Biological Process: regulation of metabolic process (GO:0019222);; Biological Process: aromatic compound catabolic process (GO:0019439);; Biological Process: protein metabolic process (GO:0019538);; Biological Process: cellular component assembly (GO:0022607);; Biological Process: ribonucleoprotein complex biogenesis (GO:0022613);; Biological Process: ribonucleoprotein complex assembly (GO:0022618);; Cellular Component: cytosolic ribosome (GO:0022626);; Cellular Component: cytosolic small ribosomal subunit (GO:0022627);; Cellular Component: membrane-enclosed lumen (GO:0031974);; Cellular Component: nuclear lumen (GO:0031981);; Biological Process: multicellular organismal process (GO:0032501);; Biological Process: developmental process (GO:0032502);; Cellular Component: protein-containing complex (GO:0032991);; Biological Process: macromolecule localization (GO:0033036);; Biological Process: protein localization to organelle (GO:0033365);; Biological Process: cellular protein localization (GO:0034613);; Biological Process: cellular protein-containing complex assembly (GO:0034622);; Biological Process: cellular nitrogen compound metabolic process (GO:0034641);; Biological Process: cellular macromolecule biosynthetic process (GO:0034645);; Biological Process: nucleobase-containing compound catabolic process (GO:0034655);; Biological Process: ribosome biogenesis (GO:0042254);; Biological Process: ribosome assembly (GO:0042255);; Biological Process: ribosomal small subunit biogenesis (GO:0042274);; Biological Process: amide transport (GO:0042886);; Biological Process: peptide biosynthetic process (GO:0043043);; Biological Process: macromolecule metabolic process (GO:0043170);; Cellular Component: organelle (GO:0043226);; Cellular Component: membrane-bounded organelle (GO:0043227);; Cellular Component: non-membrane-bounded organelle (GO:0043228);; Cellular Component: intracellular organelle (GO:0043229);; Cellular Component: intracellular membrane-bounded organelle (GO:0043231);; Cellular Component: intracellular non-membrane-bounded organelle (GO:0043232);; Cellular Component: organelle lumen (GO:0043233);; Biological Process: cellular amide metabolic process (GO:0043603);; Biological Process: amide biosynthetic process (GO:0043604);; Biological Process: protein-containing complex subunit organization (GO:0043933);; Biological Process: cellular component biogenesis (GO:0044085);; Biological Process: cellular metabolic process (GO:0044237);; Biological Process: primary metabolic process (GO:0044238);; Biological Process: cellular catabolic process (GO:0044248);; Biological Process: cellular biosynthetic process (GO:0044249);; Biological Process: cellular macromolecule metabolic process (GO:0044260);; Biological Process: cellular macromolecule catabolic process (GO:0044265);; Biological Process: cellular protein metabolic process (GO:0044267);; Biological Process: cellular nitrogen compound catabolic process (GO:0044270);; Biological Process: cellular nitrogen compound biosynthetic process (GO:0044271);; Cellular Component: ribosomal subunit (GO:0044391);; Cellular Component: obsolete organelle part (GO:0044422);; Cellular Component: obsolete intracellular part (GO:0044424);; Cellular Component: obsolete nuclear part (GO:0044428);; Cellular Component: obsolete cytoplasmic part (GO:0044444);; Cellular Component: obsolete cytosolic part (GO:0044445);; Cellular Component: obsolete intracellular organelle part (GO:0044446);; Cellular Component: obsolete cell part (GO:0044464);; Biological Process: protein targeting to ER (GO:0045047);; Biological Process: establishment of protein localization (GO:0045184);; Biological Process: heterocycle metabolic process (GO:0046483);; Biological Process: heterocycle catabolic process (GO:0046700);; Biological Process: intracellular transport (GO:0046907);; Biological Process: negative regulation of biological process (GO:0048519);; Biological Process: anatomical structure development (GO:0048856);; Biological Process: regulation of biological process (GO:0050789);; Biological Process: localization (GO:0051179);; Biological Process: establishment of localization (GO:0051234);; Biological Process: cellular localization (GO:0051641);; Biological Process: establishment of localization in cell (GO:0051649);; Biological Process: regulation of macromolecule metabolic process (GO:0060255);; Biological Process: protein-containing complex assembly (GO:0065003);; Biological Process: biological regulation (GO:0065007);; Cellular Component: intracellular organelle lumen (GO:0070013);; Biological Process: cellular macromolecule localization (GO:0070727);; Biological Process: organelle assembly (GO:0070925);; Biological Process: protein localization to endoplasmic reticulum (GO:0070972);; Biological Process: organic substance transport (GO:0071702);; Biological Process: organic substance metabolic process (GO:0071704);; Biological Process: nitrogen compound transport (GO:0071705);; Biological Process: ribonucleoprotein complex subunit organization (GO:0071826);; Biological Process: cellular component organization or biogenesis (GO:0071840);; Biological Process: establishment of protein localization to organelle (GO:0072594);; Biological Process: establishment of protein localization to endoplasmic reticulum (GO:0072599);; Biological Process: protein localization to membrane (GO:0072657);; Biological Process: establishment of protein localization to membrane (GO:0090150);; Biological Process: nucleic acid metabolic process (GO:0090304);; Molecular Function: organic cyclic compound binding (GO:0097159);; Biological Process: organic cyclic compound metabolic process (GO:1901360);; Biological Process: organic cyclic compound catabolic process (GO:1901361);; Molecular Function: heterocyclic compound binding (GO:1901363);; Biological Process: organonitrogen compound metabolic process (GO:1901564);; Biological Process: organonitrogen compound biosynthetic process (GO:1901566);; Biological Process: organic substance catabolic process (GO:1901575);; Biological Process: organic substance biosynthetic process (GO:1901576);; Cellular Component: ribonucleoprotein complex (GO:1990904);; 	K02947|7.3e-34|fcd:110852663|K02947 small subunit ribosomal protein S10e | (RefSeq) 40S ribosomal protein S10-like	[J]	Translation, ribosomal structure and biogenesis 	Plectin/S10 domain	40S ribosomal protein S10 OS=Lumbricus rubellus OX=35632 GN=RPS10 PE=2 SV=1	J	Translation, ribosomal structure and biogenesis	putative ribosomal protein S10 [Sipunculus nudus]	biological process: cellular process (GO:0009987);; biological process: cellular component organization or biogenesis (GO:0071840);; molecular function: binding (GO:0005488);; biological process: metabolic process (GO:0008152);; biological process: biological regulation (GO:0065007);; molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: cell part (GO:0044464);; cellular component: organelle (GO:0043226);; cellular component: membrane-enclosed lumen (GO:0031974);; cellular component: organelle part (GO:0044422);; cellular component: macromolecular complex (GO:0032991);; biological process: localization (GO:0051179);; biological process: multicellular organismal process (GO:0032501);; biological process: developmental process (GO:0032502);; biological process: single-organism process (GO:0044699)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN15302_c3_g4	--	0.01	0.00	0.00	0.00	0.00	0.00	10.80	8.77	0.31	6.36	6.15	1.16	4.1957379343578e-09	10.2327374844043	up	6.26872549907945e-12	11.496983073823	up	--	--	Biological Process: SREBP signaling pathway (GO:0032933);; Molecular Function: protein dimerization activity (GO:0046983);; 	K07197|9.6e-08|aqu:100640588|K07197 sterol regulatory element-binding transcription factor 1 | (RefSeq) sterol regulatory element-binding protein 1-like	[K]	Transcription 	Domain of unknown function (DUF2014);; Helix-loop-helix DNA-binding domain	--	K	Transcription	sterol regulatory element-binding protein 1-like, partial [Nilaparvata lugens]	biological process: cellular process (GO:0009987);; biological process: signaling (GO:0023052);; biological process: single-organism process (GO:0044699);; biological process: response to stimulus (GO:0050896);; biological process: biological regulation (GO:0065007);; molecular function: binding (GO:0005488)	--	1	p3	(CAG)6	18	2312	2329	GAGCCAACAGCAGTTCAACA	60.032	20	TGAGCTTTCCAAAGTAGGGG	59.308	20	275	2109	2383	GAGCCAACAGCAGTTCAACA	60.032	20	CAAAGTAGGGGTTTGCGTTT	59.131	20	266	2109	2374	GAGCCAACAGCAGTTCAACA	60.032	20	TTTCCAAAGTAGGGGTTTGC	59.064	20	270	2109	2378
TRINITY_DN15571_c0_g1	LOC114532728	0.00	0.00	0.06	0.00	0.00	0.00	15.38	21.47	2.30	23.86	27.04	5.35	1.28812290569361e-07	8.76399001273563	up	2.50015698563476e-11	11.043146166238	up	[IQR]	--	--	K11153|1.0e-09|ola:101167436|K11153 retinol dehydrogenase 12 [EC:1.1.1.300] | (RefSeq) retinol dehydrogenase 12-like isoform X1	[Q]	Secondary metabolites biosynthesis, transport and catabolism 	short chain dehydrogenase	--	Q	Secondary metabolites biosynthesis, transport and catabolism	WW domain-containing oxidoreductase-like [Dendronephthya gigantea]	--	Retinol metabolism (ko00830)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN15820_c0_g1	--	0.54	1.20	0.68	2.83	0.78	1.78	247.29	100.89	347.91	14.37	15.78	115.43	4.5546356555159e-33	7.9038895430574	up	2.76194226711099e-09	4.93285337704763	up	--	--	Molecular Function: protein binding (GO:0005515);; 	K13023|4.4e-09|prap:110991834|K13023 carboxypeptidase N regulatory subunit | (RefSeq) carboxypeptidase N subunit 2-like	[R]	General function prediction only 	Leucine rich repeat;; BspA type Leucine rich repeat region (6 copies);; Leucine Rich repeats (2 copies);; Leucine-rich repeat;; Leucine Rich Repeat;; Leucine Rich repeat	--	S	Function unknown	PREDICTED: leucine-rich repeat-containing protein 38-like, partial [Bactrocera oleae]	molecular function: binding (GO:0005488)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN16667_c0_g1	BMR1_03g01340	1.55	0.23	46.37	9.46	1.09	19.50	150.89	108.01	5.98	63.57	96.77	20.97	1.90141106506476e-06	5.67902769276982	up	5.15440128457634e-07	4.9313705886621	up	[O]	Posttranslational modification, protein turnover, chaperones 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K08770|3.6e-81|oaa:100077981|K08770 ubiquitin C | (RefSeq) polyubiquitin-C isoform X1	[OR]	--	Ubiquitin family;; Ubiquitin-2 like Rad60 SUMO-like;; Ribosomal L40e family;; Ubiquitin-like domain;; TANK binding kinase 1 ubiquitin-like domain;; Ubiquitin-2 like Rad60 SUMO-like;; Ubiquitin-like domain;; DUF2407 ubiquitin-like domain	Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma cruzi OX=5693 PE=2 SV=1	O	Posttranslational modification, protein turnover, chaperones	ubiquitin C [Babesia microti strain RI]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	PPAR signaling pathway (ko03320);; Ubiquitin mediated proteolysis (ko04120);; Mitophagy - animal (ko04137);; Parkinson disease (ko05012);; Kaposi sarcoma-associated herpesvirus infection (ko05167)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN16929_c0_g1	LOC100533382	0.00	0.00	0.00	0.00	0.00	0.00	9.26	5.78	0.56	3.74	5.53	1.72	6.08598951620488e-09	9.77143332009839	up	1.84387806632997e-10	10.1090391327938	up	--	--	Molecular Function: oxidoreductase activity (GO:0016491);; Molecular Function: metal ion binding (GO:0046872);; 	K00505|3.0e-08|obi:106867101|K00505 tyrosinase [EC:1.14.18.1] | (RefSeq) hemocyanin G-type, units Oda to Odg-like	--	--	Common central domain of tyrosinase	Hemocyanin G-type, units Oda to Odg OS=Enteroctopus dofleini OX=267067 GN=ODHCY PE=1 SV=1	S	Function unknown	haemocyanin [Aplysia californica]	biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699);; molecular function: catalytic activity (GO:0003824);; molecular function: binding (GO:0005488)	Tyrosine metabolism (ko00350)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN1719_c0_g2	--	967.89	74.02	131.23	402.88	463.52	306.38	19.40	15.38	31.75	88.38	18.24	82.86	5.69071950442548e-05	-4.52513370353782	down	0.00842263048366733	-2.45685457691615	down	--	--	Molecular Function: metal ion binding (GO:0046872);; 	K09542|6.7e-37|bmor:692487|K09542 crystallin, alpha B | (RefSeq) Hsp20.1; heat shock protein hsp20.1	[O]	Posttranslational modification, protein turnover, chaperones 	Hsp20/alpha crystallin family	Protein lethal(2)essential for life OS=Drosophila melanogaster OX=7227 GN=l(2)efl PE=1 SV=1	O	Posttranslational modification, protein turnover, chaperones	small heat shock protein 22.2 [Cydia pomonella]	molecular function: binding (GO:0005488)	Protein processing in endoplasmic reticulum (ko04141);; Longevity regulating pathway - multiple species (ko04213)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN1738_c0_g2	--	0.00	0.00	0.00	0.00	0.00	0.00	38.14	27.12	2.01	14.48	20.62	4.54	2.09796283732107e-09	10.1376525712336	up	2.95900373373242e-10	10.2592775022331	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: RNA binding (GO:0003723);; Molecular Function: structural constituent of ribosome (GO:0003735);; Biological Process: translation (GO:0006412);; Cellular Component: large ribosomal subunit (GO:0015934);; 	K02865|2.9e-76|myi:110440702|K02865 large subunit ribosomal protein L10Ae | (RefSeq) 60S ribosomal protein L1-B-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L1p/L10e family	60S ribosomal protein L10a OS=Caenorhabditis elegans OX=6239 GN=rpl-1 PE=3 SV=1	J	Translation, ribosomal structure and biogenesis	hypothetical protein TCAL_04938, partial [Tigriopus californicus]	molecular function: binding (GO:0005488);; molecular function: structural molecule activity (GO:0005198);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN17535_c0_g2	--	0.00	0.00	0.00	0.00	0.00	0.00	14.95	2.86	0.58	37.27	5.75	1.62	8.15246001584411e-09	9.9448706956441	up	4.46290630718334e-11	12.2446677867286	up	[P]	Inorganic ion transport and metabolism 	Molecular Function: iron ion transmembrane transporter activity (GO:0005381);; Cellular Component: high-affinity iron permease complex (GO:0033573);; 	--	--	--	Iron permease FTR1 family	--	--	--	high-affinity iron permease CaFTR1 [Planoprotostelium fungivorum]	biological process: localization (GO:0051179);; molecular function: transporter activity (GO:0005215);; cellular component: cell (GO:0005623);; cellular component: membrane (GO:0016020);; cellular component: macromolecular complex (GO:0032991);; cellular component: membrane part (GO:0044425);; cellular component: cell part (GO:0044464)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN17754_c0_g2	--	0.00	0.00	0.05	0.00	0.00	0.00	72.31	28.13	3.36	45.13	38.92	7.60	4.2298752067349e-10	10.4368032902688	up	3.0762638405504e-13	12.1745936686424	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN18433_c0_g1	--	2.54	2.57	3.15	3.60	2.11	1.85	22.08	9.84	29.54	16.19	16.81	45.51	0.000927298189641955	2.59525313621352	up	1.43391866175858e-09	3.65993900711945	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN1848_c0_g2	--	0.00	0.00	0.00	0.00	0.00	0.00	69.80	54.46	4.10	36.32	41.00	10.05	1.7851320174756e-09	10.1310023133863	up	1.03232299861911e-10	10.4856151421419	up	--	--	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translational elongation (GO:0006414);; 	K02942|2.5e-15|api:100161763|K02942 large subunit ribosomal protein LP1 | (RefSeq) ribosomal protein LP1-like	[J]	Translation, ribosomal structure and biogenesis 	60s Acidic ribosomal protein	60S acidic ribosomal protein P1 OS=Drosophila melanogaster OX=7227 GN=RpLP1 PE=1 SV=2	J	Translation, ribosomal structure and biogenesis	ribosomal LP1 [Brachionus plicatilis]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN18735_c0_g1	--	0.00	0.00	0.00	0.00	0.16	0.00	47.79	37.77	2.82	37.95	43.94	7.84	3.05490899126803e-10	10.6017197058241	up	2.73307304856905e-10	9.49971193999197	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02938|1.8e-134|sasa:100196447|K02938 large subunit ribosomal protein L8e | (RefSeq) rl2; 60S ribosomal protein L2	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal Proteins L2, C-terminal domain;; Ribosomal Proteins L2, RNA binding domain	60S ribosomal protein L8 OS=Mamestra brassicae OX=55057 GN=RpL8 PE=2 SV=1	J	Translation, ribosomal structure and biogenesis	ribosomal protein L2 [Perkinsus sp. BL_2016]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN18783_c0_g1	LOC110440653	0.00	0.00	0.00	0.62	0.00	0.00	31.08	23.75	4.60	18.42	17.42	5.56	1.22089895078806e-08	9.12272788812256	up	8.58804739233342e-08	7.18994191899168	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02962|1.4e-40|myi:110440653|K02962 small subunit ribosomal protein S17e | (RefSeq) 40S ribosomal protein S17-B-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal S17	40S ribosomal protein S17 OS=Anopheles gambiae OX=7165 GN=RpS17 PE=2 SV=3	J	Translation, ribosomal structure and biogenesis	40S ribosomal protein S17-B-like, partial [Mizuhopecten yessoensis]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN1895_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	13.24	4.52	0.43	10.81	6.30	1.66	1.9169393158027e-09	10.4111267101587	up	7.29817884398058e-12	11.4018278681515	up	[O]	Posttranslational modification, protein turnover, chaperones 	Molecular Function: nucleotide binding (GO:0000166);; Molecular Function: nucleoside binding (GO:0001882);; Molecular Function: purine nucleoside binding (GO:0001883);; Biological Process: activation of immune response (GO:0002253);; Biological Process: immune system process (GO:0002376);; Biological Process: immune response-activating cell surface receptor signaling pathway (GO:0002429);; Biological Process: regulation of immune system process (GO:0002682);; Biological Process: positive regulation of immune system process (GO:0002684);; Biological Process: immune response-activating signal transduction (GO:0002757);; Biological Process: immune response-regulating signaling pathway (GO:0002764);; Biological Process: immune response-regulating cell surface receptor signaling pathway (GO:0002768);; Molecular Function: molecular_function (GO:0003674);; Molecular Function: nucleic acid binding (GO:0003676);; Molecular Function: RNA binding (GO:0003723);; Molecular Function: translation initiation factor activity (GO:0003743);; Molecular Function: binding (GO:0005488);; Molecular Function: protein binding (GO:0005515);; Molecular Function: GTP binding (GO:0005525);; Cellular Component: cellular_component (GO:0005575);; Cellular Component: intracellular (GO:0005622);; Cellular Component: obsolete cell (GO:0005623);; Cellular Component: cytoplasm (GO:0005737);; Cellular Component: cytosol (GO:0005829);; Cellular Component: eukaryotic translation initiation factor 2 complex (GO:0005850);; Cellular Component: eukaryotic translation initiation factor 2B complex (GO:0005851);; Cellular Component: plasma membrane (GO:0005886);; Biological Process: translation (GO:0006412);; Biological Process: translational initiation (GO:0006413);; Biological Process: peptide metabolic process (GO:0006518);; Biological Process: nitrogen compound metabolic process (GO:0006807);; Biological Process: response to stress (GO:0006950);; Biological Process: cell communication (GO:0007154);; Biological Process: signal transduction (GO:0007165);; Biological Process: cell surface receptor signaling pathway (GO:0007166);; Biological Process: multicellular organism development (GO:0007275);; Biological Process: nervous system development (GO:0007399);; Biological Process: central nervous system development (GO:0007417);; Molecular Function: translation factor activity, RNA binding (GO:0008135);; Biological Process: biological_process (GO:0008150);; Biological Process: metabolic process (GO:0008152);; Biological Process: biosynthetic process (GO:0009058);; Biological Process: macromolecule biosynthetic process (GO:0009059);; Biological Process: response to temperature stimulus (GO:0009266);; Biological Process: response to heat (GO:0009408);; Biological Process: response to external stimulus (GO:0009605);; Biological Process: response to abiotic stimulus (GO:0009628);; Biological Process: response to endogenous stimulus (GO:0009719);; Biological Process: response to hormone (GO:0009725);; Biological Process: response to carbohydrate (GO:0009743);; Biological Process: response to hexose (GO:0009746);; Biological Process: response to glucose (GO:0009749);; Biological Process: cellular process (GO:0009987);; Biological Process: response to extracellular stimulus (GO:0009991);; Biological Process: glial cell differentiation (GO:0010001);; Biological Process: response to organic substance (GO:0010033);; Biological Process: response to organonitrogen compound (GO:0010243);; Biological Process: gene expression (GO:0010467);; Biological Process: oligodendrocyte development (GO:0014003);; Cellular Component: membrane (GO:0016020);; Molecular Function: purine nucleotide binding (GO:0017076);; Molecular Function: guanyl nucleotide binding (GO:0019001);; Molecular Function: GDP binding (GO:0019003);; Biological Process: protein metabolic process (GO:0019538);; Biological Process: glial cell development (GO:0021782);; Biological Process: neurogenesis (GO:0022008);; Biological Process: signaling (GO:0023052);; Biological Process: cell differentiation (GO:0030154);; Molecular Function: enzyme regulator activity (GO:0030234);; Biological Process: response to nutrient levels (GO:0031667);; Biological Process: negative regulation of protein binding (GO:0032091);; Biological Process: multicellular organismal process (GO:0032501);; Biological Process: developmental process (GO:0032502);; Molecular Function: ribonucleoside binding (GO:0032549);; Molecular Function: purine ribonucleoside binding (GO:0032550);; Molecular Function: ribonucleotide binding (GO:0032553);; Molecular Function: purine ribonucleotide binding (GO:0032555);; Molecular Function: guanyl ribonucleotide binding (GO:0032561);; Cellular Component: protein-containing complex (GO:0032991);; Biological Process: response to monosaccharide (GO:0034284);; Biological Process: cellular nitrogen compound metabolic process (GO:0034641);; Biological Process: cellular macromolecule biosynthetic process (GO:0034645);; Molecular Function: purine ribonucleoside triphosphate binding (GO:0035639);; Molecular Function: small molecule binding (GO:0036094);; Biological Process: gliogenesis (GO:0042063);; Biological Process: response to chemical (GO:0042221);; Biological Process: response to starvation (GO:0042594);; Molecular Function: identical protein binding (GO:0042802);; Biological Process: peptide biosynthetic process (GO:0043043);; Molecular Function: ion binding (GO:0043167);; Molecular Function: anion binding (GO:0043168);; Biological Process: macromolecule metabolic process (GO:0043170);; Biological Process: regulation of protein binding (GO:0043393);; Biological Process: response to peptide hormone (GO:0043434);; Biological Process: cellular amide metabolic process (GO:0043603);; Biological Process: amide biosynthetic process (GO:0043604);; Biological Process: negative regulation of molecular function (GO:0044092);; Biological Process: positive regulation of molecular function (GO:0044093);; Biological Process: cellular metabolic process (GO:0044237);; Biological Process: primary metabolic process (GO:0044238);; Biological Process: cellular biosynthetic process (GO:0044249);; Biological Process: cellular macromolecule metabolic process (GO:0044260);; Biological Process: cellular protein metabolic process (GO:0044267);; Biological Process: cellular nitrogen compound biosynthetic process (GO:0044271);; Cellular Component: obsolete intracellular part (GO:0044424);; Cellular Component: obsolete cytoplasmic part (GO:0044444);; Cellular Component: obsolete cell part (GO:0044464);; Biological Process: cell development (GO:0048468);; Biological Process: positive regulation of biological process (GO:0048518);; Biological Process: negative regulation of biological process (GO:0048519);; Biological Process: regulation of response to stimulus (GO:0048583);; Biological Process: positive regulation of response to stimulus (GO:0048584);; Biological Process: oligodendrocyte differentiation (GO:0048709);; Biological Process: system development (GO:0048731);; Biological Process: anatomical structure development (GO:0048856);; Biological Process: cellular developmental process (GO:0048869);; Biological Process: regulation of immune response (GO:0050776);; Biological Process: positive regulation of immune response (GO:0050778);; Biological Process: regulation of biological process (GO:0050789);; Biological Process: regulation of catalytic activity (GO:0050790);; Biological Process: regulation of cellular process (GO:0050794);; Biological Process: antigen receptor-mediated signaling pathway (GO:0050851);; Biological Process: T cell receptor signaling pathway (GO:0050852);; Biological Process: response to stimulus (GO:0050896);; Biological Process: regulation of binding (GO:0051098);; Biological Process: positive regulation of binding (GO:0051099);; Biological Process: negative regulation of binding (GO:0051100);; Biological Process: cellular response to stimulus (GO:0051716);; Biological Process: biological regulation (GO:0065007);; Biological Process: regulation of molecular function (GO:0065009);; Biological Process: organic substance metabolic process (GO:0071704);; Cellular Component: cell periphery (GO:0071944);; Molecular Function: organic cyclic compound binding (GO:0097159);; Molecular Function: carbohydrate derivative binding (GO:0097367);; Molecular Function: molecular function regulator (GO:0098772);; Molecular Function: nucleoside phosphate binding (GO:1901265);; Molecular Function: heterocyclic compound binding (GO:1901363);; Biological Process: organonitrogen compound metabolic process (GO:1901564);; Biological Process: organonitrogen compound biosynthetic process (GO:1901566);; Biological Process: organic substance biosynthetic process (GO:1901576);; Biological Process: response to peptide (GO:1901652);; Biological Process: response to nitrogen compound (GO:1901698);; Biological Process: response to oxygen-containing compound (GO:1901700);; Biological Process: regulation of GTP binding (GO:1904424);; Biological Process: regulation of guanyl-nucleotide exchange factor activity (GO:1905097);; Biological Process: negative regulation of guanyl-nucleotide exchange factor activity (GO:1905098);; Biological Process: response to amino acid starvation (GO:1990928);; 	K03239|3.6e-36|salp:111981151|K03239 translation initiation factor eIF-2B subunit alpha | (RefSeq) eif2b1; translation initiation factor eIF-2B subunit alpha	--	--	Sulfatase-modifying factor enzyme 1;; Initiation factor 2 subunit family;; Histidine-specific methyltransferase, SAM-dependent	Translation initiation factor eIF-2B subunit alpha OS=Dictyostelium discoideum OX=44689 GN=eif2b1 PE=3 SV=1	J	Translation, ribosomal structure and biogenesis	unnamed protein product [Plasmodiophora brassicae]	molecular function: binding (GO:0005488);; biological process: immune system process (GO:0002376);; biological process: biological regulation (GO:0065007);; biological process: cellular process (GO:0009987);; biological process: signaling (GO:0023052);; biological process: single-organism process (GO:0044699);; biological process: response to stimulus (GO:0050896);; biological process: metabolic process (GO:0008152);; cellular component: cell (GO:0005623);; cellular component: cell part (GO:0044464);; cellular component: macromolecular complex (GO:0032991);; cellular component: membrane (GO:0016020);; biological process: multicellular organismal process (GO:0032501);; biological process: developmental process (GO:0032502);; molecular function: molecular function regulator (GO:0098772)	RNA transport (ko03013);; Herpes simplex virus 1 infection (ko05168)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN19209_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	37.53	19.57	2.77	16.05	24.89	4.32	1.82878666285119e-08	9.40544857645869	up	1.5213163113146e-09	9.9974717346924	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02921|1.2e-32|fcd:110846475|K02921 large subunit ribosomal protein L37Ae | (RefSeq) 60S ribosomal protein L37a	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal L37ae protein family	60S ribosomal protein L37a OS=Ostertagia ostertagi OX=6317 GN=rpl-37a PE=3 SV=3	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L37a-like [Tropilaelaps mercedesae]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN19472_c0_g1	--	0.00	0.00	0.00	0.00	0.02	0.00	19.40	13.76	0.48	1.40	8.80	2.38	3.77934867258306e-05	11.1136650920767	up	8.18907795286531e-09	9.55690095598674	up	[P]	Inorganic ion transport and metabolism 	Molecular Function: catalase activity (GO:0004096);; Biological Process: response to oxidative stress (GO:0006979);; Molecular Function: heme binding (GO:0020037);; Biological Process: hydrogen peroxide catabolic process (GO:0042744);; Molecular Function: metal ion binding (GO:0046872);; 	K03782|1.2e-234|pxy:105396560|K03782 catalase-peroxidase [EC:1.11.1.21] | (RefSeq) catalase-peroxidase-like	--	--	Peroxidase	--	--	--	hypothetical protein FGO68_gene11022 [Halteria grandinella]	biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; biological process: single-organism process (GO:0044699);; biological process: response to stimulus (GO:0050896);; biological process: detoxification (GO:0098754);; molecular function: catalytic activity (GO:0003824);; molecular function: antioxidant activity (GO:0016209);; molecular function: binding (GO:0005488)	Phenylalanine metabolism (ko00360);; Tryptophan metabolism (ko00380);; Drug metabolism - other enzymes (ko00983)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN19602_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	138.97	102.55	2.66	110.71	59.35	19.73	8.49498173949706e-07	13.1651850042595	up	1.14336610276538e-16	13.6459175336141	up	--	--	--	--	--	--	Yeast PIR protein repeat	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN20231_c0_g1	LOC114958377	0.00	0.00	0.00	0.00	0.00	0.00	55.93	57.33	3.50	25.09	42.11	5.17	1.23981075498767e-10	10.904989860234	up	8.16176083288991e-11	11.0498476061768	up	--	--	Cellular Component: nucleosome (GO:0000786);; Molecular Function: DNA binding (GO:0003677);; Cellular Component: nucleus (GO:0005634);; Molecular Function: protein heterodimerization activity (GO:0046982);; 	K11252|3.8e-20|sko:100377527|K11252 histone H2B | (RefSeq) late histone H2B.L3-like	[B]	Chromatin structure and dynamics 	Core histone H2A/H2B/H3/H4	Probable histone H2B 3 OS=Caenorhabditis elegans OX=6239 GN=his-41 PE=3 SV=3	B	Chromatin structure and dynamics	late histone H2B.L4-like [Acropora millepora]	cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464);; molecular function: binding (GO:0005488)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN21145_c0_g1	LOC110440742	0.00	0.00	0.00	0.00	0.00	0.00	29.36	22.40	1.94	15.65	19.34	5.15	1.32601963219092e-09	10.156299049022	up	4.79020554220723e-11	10.5907338321651	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; Molecular Function: 5S rRNA binding (GO:0008097);; 	K02932|1.1e-87|myi:110440742|K02932 large subunit ribosomal protein L5e | (RefSeq) 60S ribosomal protein L5-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal large subunit proteins 60S L5, and 50S L18;; Ribosomal L18 C-terminal region	60S ribosomal protein L5 OS=Styela clava OX=7725 GN=RPL5 PE=3 SV=3	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L5-like, partial [Mizuhopecten yessoensis]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; molecular function: binding (GO:0005488)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN21173_c0_g1	LOC110440669	0.00	0.00	0.00	0.00	0.00	0.00	27.95	15.57	2.16	16.68	17.22	5.75	8.64287357300257e-09	9.50433982677891	up	1.41141997399681e-10	10.1887791865124	up	--	--	Biological Process: ribosomal large subunit assembly (GO:0000027);; Biological Process: cell cycle checkpoint (GO:0000075);; Biological Process: nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184);; Biological Process: mitotic cell cycle (GO:0000278);; Biological Process: nuclear division (GO:0000280);; Biological Process: cell morphogenesis (GO:0000902);; Biological Process: cell morphogenesis involved in differentiation (GO:0000904);; Biological Process: nuclear-transcribed mRNA catabolic process (GO:0000956);; Biological Process: eye development (GO:0001654);; Biological Process: cytoplasmic translation (GO:0002181);; Molecular Function: molecular_function (GO:0003674);; Molecular Function: nucleic acid binding (GO:0003676);; Molecular Function: RNA binding (GO:0003723);; Molecular Function: structural constituent of ribosome (GO:0003735);; Molecular Function: structural molecule activity (GO:0005198);; Molecular Function: binding (GO:0005488);; Cellular Component: cellular_component (GO:0005575);; Cellular Component: intracellular (GO:0005622);; Cellular Component: obsolete cell (GO:0005623);; Cellular Component: cytoplasm (GO:0005737);; Cellular Component: endoplasmic reticulum (GO:0005783);; Cellular Component: cytosol (GO:0005829);; Cellular Component: ribosome (GO:0005840);; Cellular Component: polysome (GO:0005844);; Biological Process: nucleobase-containing compound metabolic process (GO:0006139);; Biological Process: RNA catabolic process (GO:0006401);; Biological Process: mRNA catabolic process (GO:0006402);; Biological Process: translation (GO:0006412);; Biological Process: translational initiation (GO:0006413);; Biological Process: peptide metabolic process (GO:0006518);; Biological Process: protein targeting (GO:0006605);; Biological Process: protein targeting to membrane (GO:0006612);; Biological Process: cotranslational protein targeting to membrane (GO:0006613);; Biological Process: SRP-dependent cotranslational protein targeting to membrane (GO:0006614);; Biological Process: cellular aromatic compound metabolic process (GO:0006725);; Biological Process: nitrogen compound metabolic process (GO:0006807);; Biological Process: transport (GO:0006810);; Biological Process: intracellular protein transport (GO:0006886);; Biological Process: movement of cell or subcellular component (GO:0006928);; Biological Process: chemotaxis (GO:0006935);; Biological Process: organelle organization (GO:0006996);; Biological Process: cell cycle (GO:0007049);; Biological Process: mitotic cell cycle checkpoint (GO:0007093);; Biological Process: multicellular organism development (GO:0007275);; Biological Process: regulation of mitotic cell cycle (GO:0007346);; Biological Process: nervous system development (GO:0007399);; Biological Process: axonogenesis (GO:0007409);; Biological Process: axon guidance (GO:0007411);; Biological Process: sensory organ development (GO:0007423);; Biological Process: protein localization (GO:0008104);; Biological Process: biological_process (GO:0008150);; Biological Process: metabolic process (GO:0008152);; Biological Process: catabolic process (GO:0009056);; Biological Process: macromolecule catabolic process (GO:0009057);; Biological Process: biosynthetic process (GO:0009058);; Biological Process: macromolecule biosynthetic process (GO:0009059);; Biological Process: response to external stimulus (GO:0009605);; Biological Process: anatomical structure morphogenesis (GO:0009653);; Biological Process: embryo development (GO:0009790);; Biological Process: embryo development ending in birth or egg hatching (GO:0009792);; Biological Process: negative regulation of metabolic process (GO:0009892);; Biological Process: cellular process (GO:0009987);; Biological Process: exit from mitosis (GO:0010458);; Biological Process: gene expression (GO:0010467);; Biological Process: regulation of gene expression (GO:0010468);; Biological Process: negative regulation of macromolecule metabolic process (GO:0010605);; Biological Process: negative regulation of gene expression (GO:0010629);; Cellular Component: endomembrane system (GO:0012505);; Biological Process: protein transport (GO:0015031);; Biological Process: peptide transport (GO:0015833);; Cellular Component: large ribosomal subunit (GO:0015934);; Biological Process: cellular component organization (GO:0016043);; Biological Process: RNA metabolic process (GO:0016070);; Biological Process: mRNA metabolic process (GO:0016071);; Biological Process: regulation of metabolic process (GO:0019222);; Biological Process: aromatic compound catabolic process (GO:0019439);; Biological Process: protein metabolic process (GO:0019538);; Biological Process: cranial nerve development (GO:0021545);; Biological Process: optic nerve development (GO:0021554);; Biological Process: nerve development (GO:0021675);; Biological Process: neurogenesis (GO:0022008);; Biological Process: cell cycle process (GO:0022402);; Biological Process: cellular component assembly (GO:0022607);; Biological Process: ribonucleoprotein complex biogenesis (GO:0022613);; Biological Process: ribonucleoprotein complex assembly (GO:0022618);; Cellular Component: cytosolic large ribosomal subunit (GO:0022625);; Cellular Component: cytosolic ribosome (GO:0022626);; Biological Process: cell projection organization (GO:0030030);; Biological Process: cell differentiation (GO:0030154);; Biological Process: neuron differentiation (GO:0030182);; Biological Process: neuron projection development (GO:0031175);; Biological Process: retinal ganglion cell axon guidance (GO:0031290);; Biological Process: multicellular organismal process (GO:0032501);; Biological Process: developmental process (GO:0032502);; Biological Process: cellular component morphogenesis (GO:0032989);; Biological Process: cell part morphogenesis (GO:0032990);; Cellular Component: protein-containing complex (GO:0032991);; Biological Process: macromolecule localization (GO:0033036);; Biological Process: protein localization to organelle (GO:0033365);; Biological Process: cellular protein localization (GO:0034613);; Biological Process: cellular protein-containing complex assembly (GO:0034622);; Biological Process: cellular nitrogen compound metabolic process (GO:0034641);; Biological Process: cellular macromolecule biosynthetic process (GO:0034645);; Biological Process: nucleobase-containing compound catabolic process (GO:0034655);; Biological Process: locomotion (GO:0040011);; Biological Process: response to chemical (GO:0042221);; Biological Process: ribosome biogenesis (GO:0042254);; Biological Process: ribosome assembly (GO:0042255);; Biological Process: ribosomal large subunit biogenesis (GO:0042273);; Biological Process: taxis (GO:0042330);; Cellular Component: polysomal ribosome (GO:0042788);; Biological Process: amide transport (GO:0042886);; Biological Process: chordate embryonic development (GO:0043009);; Biological Process: camera-type eye development (GO:0043010);; Biological Process: peptide biosynthetic process (GO:0043043);; Biological Process: macromolecule metabolic process (GO:0043170);; Cellular Component: organelle (GO:0043226);; Cellular Component: membrane-bounded organelle (GO:0043227);; Cellular Component: non-membrane-bounded organelle (GO:0043228);; Cellular Component: intracellular organelle (GO:0043229);; Cellular Component: intracellular membrane-bounded organelle (GO:0043231);; Cellular Component: intracellular non-membrane-bounded organelle (GO:0043232);; Biological Process: cellular amide metabolic process (GO:0043603);; Biological Process: amide biosynthetic process (GO:0043604);; Biological Process: protein-containing complex subunit organization (GO:0043933);; Biological Process: cellular component biogenesis (GO:0044085);; Biological Process: cellular metabolic process (GO:0044237);; Biological Process: primary metabolic process (GO:0044238);; Biological Process: cellular catabolic process (GO:0044248);; Biological Process: cellular biosynthetic process (GO:0044249);; Biological Process: cellular macromolecule metabolic process (GO:0044260);; Biological Process: cellular macromolecule catabolic process (GO:0044265);; Biological Process: cellular protein metabolic process (GO:0044267);; Biological Process: cellular nitrogen compound catabolic process (GO:0044270);; Biological Process: cellular nitrogen compound biosynthetic process (GO:0044271);; Cellular Component: ribosomal subunit (GO:0044391);; Cellular Component: obsolete organelle part (GO:0044422);; Cellular Component: obsolete intracellular part (GO:0044424);; Cellular Component: obsolete cytoplasmic part (GO:0044444);; Cellular Component: obsolete cytosolic part (GO:0044445);; Cellular Component: obsolete intracellular organelle part (GO:0044446);; Cellular Component: obsolete cell part (GO:0044464);; Biological Process: cell cycle phase transition (GO:0044770);; Biological Process: mitotic cell cycle phase transition (GO:0044772);; Biological Process: protein targeting to ER (GO:0045047);; Biological Process: establishment of protein localization (GO:0045184);; Biological Process: negative regulation of cell cycle (GO:0045786);; Biological Process: negative regulation of mitotic cell cycle (GO:0045930);; Biological Process: heterocycle metabolic process (GO:0046483);; Biological Process: heterocycle catabolic process (GO:0046700);; Biological Process: intracellular transport (GO:0046907);; Biological Process: organelle fission (GO:0048285);; Biological Process: cell development (GO:0048468);; Biological Process: animal organ development (GO:0048513);; Biological Process: negative regulation of biological process (GO:0048519);; Biological Process: negative regulation of cellular process (GO:0048523);; Biological Process: neuron development (GO:0048666);; Biological Process: cell morphogenesis involved in neuron differentiation (GO:0048667);; Biological Process: generation of neurons (GO:0048699);; Biological Process: system development (GO:0048731);; Biological Process: neuron projection morphogenesis (GO:0048812);; Biological Process: anatomical structure development (GO:0048856);; Biological Process: cell projection morphogenesis (GO:0048858);; Biological Process: cellular developmental process (GO:0048869);; Biological Process: regulation of biological process (GO:0050789);; Biological Process: regulation of cellular process (GO:0050794);; Biological Process: response to stimulus (GO:0050896);; Biological Process: localization (GO:0051179);; Biological Process: establishment of localization (GO:0051234);; Biological Process: cellular localization (GO:0051641);; Biological Process: establishment of localization in cell (GO:0051649);; Biological Process: regulation of cell cycle (GO:0051726);; Biological Process: retina development in camera-type eye (GO:0060041);; Biological Process: regulation of macromolecule metabolic process (GO:0060255);; Biological Process: axon development (GO:0061564);; Biological Process: protein-containing complex assembly (GO:0065003);; Biological Process: biological regulation (GO:0065007);; Biological Process: cellular macromolecule localization (GO:0070727);; Biological Process: organelle assembly (GO:0070925);; Biological Process: protein localization to endoplasmic reticulum (GO:0070972);; Biological Process: organic substance transport (GO:0071702);; Biological Process: organic substance metabolic process (GO:0071704);; Biological Process: nitrogen compound transport (GO:0071705);; Biological Process: ribonucleoprotein complex subunit organization (GO:0071826);; Biological Process: cellular component organization or biogenesis (GO:0071840);; Biological Process: establishment of protein localization to organelle (GO:0072594);; Biological Process: establishment of protein localization to endoplasmic reticulum (GO:0072599);; Biological Process: protein localization to membrane (GO:0072657);; Biological Process: establishment of protein localization to membrane (GO:0090150);; Biological Process: nucleic acid metabolic process (GO:0090304);; Molecular Function: organic cyclic compound binding (GO:0097159);; Biological Process: neuron projection guidance (GO:0097485);; Biological Process: plasma membrane bounded cell projection organization (GO:0120036);; Biological Process: plasma membrane bounded cell projection morphogenesis (GO:0120039);; Biological Process: mitotic nuclear division (GO:0140014);; Biological Process: organic cyclic compound metabolic process (GO:1901360);; Biological Process: organic cyclic compound catabolic process (GO:1901361);; Molecular Function: heterocyclic compound binding (GO:1901363);; Biological Process: organonitrogen compound metabolic process (GO:1901564);; Biological Process: organonitrogen compound biosynthetic process (GO:1901566);; Biological Process: organic substance catabolic process (GO:1901575);; Biological Process: organic substance biosynthetic process (GO:1901576);; Biological Process: assembly of large subunit precursor of preribosome (GO:1902626);; Biological Process: mitotic cell cycle process (GO:1903047);; Cellular Component: ribonucleoprotein complex (GO:1990904);; 	K02896|4.2e-32|myi:110440669|K02896 large subunit ribosomal protein L24e | (RefSeq) 60S ribosomal protein L24-A-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L24e	60S ribosomal protein L24 OS=Drosophila melanogaster OX=7227 GN=RpL24 PE=1 SV=1	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L24-A-like [Mizuhopecten yessoensis]	biological process: cellular process (GO:0009987);; biological process: cellular component organization or biogenesis (GO:0071840);; biological process: biological regulation (GO:0065007);; biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699);; biological process: developmental process (GO:0032502);; biological process: multicellular organismal process (GO:0032501);; molecular function: binding (GO:0005488);; molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: cell part (GO:0044464);; cellular component: organelle (GO:0043226);; cellular component: macromolecular complex (GO:0032991);; biological process: localization (GO:0051179);; biological process: locomotion (GO:0040011);; biological process: response to stimulus (GO:0050896);; cellular component: organelle part (GO:0044422)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN2179_c0_g1	--	1.80	0.21	4.11	0.11	1.57	0.79	57.23	41.66	49.70	5.82	17.30	6.83	3.0501896974681e-06	4.2981249935853	up	0.00290180324229123	3.78083765820135	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN22353_c0_g2	ACA1_209240	0.00	0.00	0.00	0.00	0.00	0.00	28.30	15.57	0.98	11.43	18.07	3.29	1.30620036143828e-09	10.4542253418362	up	4.25162510775293e-11	10.912335593256	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: RNA binding (GO:0003723);; 	K13195|6.7e-19|npr:108789497|K13195 cold-inducible RNA-binding protein | (RefSeq) cold-inducible RNA-binding protein B-like isoform X1	[R]	General function prediction only 	RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)	RNA-binding protein Musashi homolog Rbp6 OS=Drosophila melanogaster OX=7227 GN=Rbp6 PE=2 SV=3	A	RNA processing and modification	RNA recognition motif domain containing protein [Acanthamoeba castellanii str. Neff]	molecular function: binding (GO:0005488)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN2247_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	70.96	32.43	2.05	30.61	25.66	13.11	1.32601963219092e-09	10.5104727104092	up	3.08909857756329e-12	10.8202588994018	up	--	--	Cellular Component: integral component of membrane (GO:0016021);; 	--	--	--	--	--	--	--	--	cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN224_c0_g1	DESAT4	313.96	1621.76	499.47	1552.77	518.41	490.06	120.81	106.60	76.17	85.73	55.03	165.22	0.000346239412050383	-2.77829226726305	down	0.000346643222790722	-2.07823772030483	down	[I]	Lipid transport and metabolism 	Biological Process: fatty acid biosynthetic process (GO:0006633);; Cellular Component: integral component of membrane (GO:0016021);; Molecular Function: oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (GO:0016717);; 	K00507|1.0e-172|bmor:692518|K00507 stearoyl-CoA desaturase (Delta-9 desaturase) [EC:1.14.19.1] | (RefSeq) DESAT4; fatty acid desaturase	[I]	Lipid transport and metabolism 	Fatty acid desaturase	Acyl-CoA Delta(11) desaturase OS=Trichoplusia ni OX=7111 GN=D11DS PE=1 SV=2	I	Lipid transport and metabolism	uncharacterized protein LOC692518 [Bombyx mori]	biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; biological process: single-organism process (GO:0044699);; cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425);; molecular function: catalytic activity (GO:0003824)	Biosynthesis of unsaturated fatty acids (ko01040);; Fatty acid metabolism (ko01212)	1	p2	(AT)6	12	399	410	TTGTTGAATGCCACCAAAAT	58.869	20	CTCGCAAGGGACTGAGGTAT	59.308	20	255	225	479	TTTGTTGAATGCCACCAAAAT	60.216	21	CTCGCAAGGGACTGAGGTAT	59.308	20	256	224	479	TTGTTGAATGCCACCAAAAT	58.869	20	AGGAAAGAACGAATTGCCGT	60.987	20	280	225	504
TRINITY_DN2272_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	24.63	12.69	0.80	19.87	11.82	1.82	1.40211599850232e-09	10.4684829308394	up	1.02444711222773e-10	11.1929944859293	up	[G]	Carbohydrate transport and metabolism 	Molecular Function: channel activity (GO:0015267);; Cellular Component: integral component of membrane (GO:0016021);; 	K09876|2.7e-46|fch:102056948|K09876 aquaporin-3 | (RefSeq) aquaporin-3 isoform X1	[G]	Carbohydrate transport and metabolism 	Major intrinsic protein	Aquaporin-10 OS=Milnesium tardigradum OX=46460 GN=AQP10 PE=1 SV=1	G	Carbohydrate transport and metabolism	hypothetical protein CAPTEDRAFT_125390 [Capitella teleta]	biological process: localization (GO:0051179);; molecular function: transporter activity (GO:0005215);; cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN2286_c0_g1	LOC110440734	0.00	0.00	0.00	0.00	0.00	0.00	34.39	24.70	1.67	12.80	21.59	4.52	1.12885655840313e-09	10.3472291501113	up	1.04316255343572e-10	10.5853532163035	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: RNA binding (GO:0003723);; Cellular Component: cytosolic large ribosomal subunit (GO:0022625);; Biological Process: ribosome biogenesis (GO:0042254);; 	K02936|4.2e-81|myi:110440734|K02936 large subunit ribosomal protein L7Ae | (RefSeq) 60S ribosomal protein L8-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L7Ae/L30e/S12e/Gadd45 family	60S ribosomal protein L7a OS=Anopheles gambiae OX=7165 GN=RpL7A PE=3 SV=2	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L8-like [Mizuhopecten yessoensis]	molecular function: binding (GO:0005488);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464);; biological process: cellular component organization or biogenesis (GO:0071840)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN2314_c0_g1	LOC108680269	0.00	0.00	0.00	0.00	0.00	0.00	0.54	14.93	1.13	9.64	6.93	46.82	0.001685491884673	10.4891422294642	up	9.184180670515e-16	12.5467941258087	up	[X]	Mobilome: prophages, transposons	Molecular Function: nucleic acid binding (GO:0003676);; Molecular Function: endonuclease activity (GO:0004519);; 	--	[A]	RNA processing and modification 	Reverse transcriptase (RNA-dependent DNA polymerase)	--	L	Replication, recombination and repair	PREDICTED: putative uncharacterized protein YkfC, partial [Hyalella azteca]	molecular function: binding (GO:0005488);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; molecular function: catalytic activity (GO:0003824)	--	1	c	(T)10aattttca(T)10	28	1962	1989	AAATCTTTCGCCAATTGCAC	60.081	20	CCGAATTTTGCATGTGTCAT	59.400	20	224	1872	2095	CACGCTTGGATTCGCTTAGT	60.407	20	TGCATGTGTCATAAGTGCCA	59.701	20	199	1889	2087	CACTCATTTTTGTGCGAAGC	59.469	20	TGCATGTGTCATAAGTGCCA	59.701	20	269	1819	2087
TRINITY_DN2339_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	106.41	30.55	1.96	25.26	32.94	11.32	5.21081748017142e-06	12.1271062949031	up	1.77556623696318e-14	12.0837483647846	up	[G]	Carbohydrate transport and metabolism 	Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553);; Biological Process: carbohydrate metabolic process (GO:0005975);; Molecular Function: chitin binding (GO:0008061);; 	K01183|5.9e-40|dvi:6623151|K01183 chitinase [EC:3.2.1.14] | (RefSeq) probable chitinase 10	[G]	Carbohydrate transport and metabolism 	Glycosyl hydrolases family 18	Probable endochitinase OS=Caenorhabditis elegans OX=6239 GN=cht-1 PE=1 SV=1	G	Carbohydrate transport and metabolism	hypothetical protein FGO68_gene15926 [Halteria grandinella]	molecular function: catalytic activity (GO:0003824);; biological process: metabolic process (GO:0008152);; molecular function: binding (GO:0005488)	Amino sugar and nucleotide sugar metabolism (ko00520)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN2363_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	55.57	19.51	0.99	27.15	12.41	2.56	8.0980505183977e-06	12.0161786402731	up	2.6778825764207e-12	12.111628029215	up	[G]	Carbohydrate transport and metabolism 	--	--	--	--	Peptidase M60, enhancin and enhancin-like;; N-terminal domain of M60-like peptidases	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN24336_c1_g3	--	0.00	0.00	0.18	0.28	0.07	0.00	11.70	8.76	0.75	6.94	7.28	1.22	3.56806203502531e-07	7.37993876508481	up	2.5433880786169e-08	7.06326602090065	up	[C]	Energy production and conversion 	Molecular Function: ATP binding (GO:0005524);; Biological Process: ATP synthesis coupled proton transport (GO:0015986);; Cellular Component: proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261);; Molecular Function: proton-transporting ATP synthase activity, rotational mechanism (GO:0046933);; 	K02133|4.1e-209|sgh:107602797|K02133 F-type H+-transporting ATPase subunit beta [EC:7.1.2.2] | (RefSeq) atp5b; ATP synthase subunit beta, mitochondrial	[C]	Energy production and conversion 	ATP synthase alpha/beta family, nucleotide-binding domain;; ATP synthase alpha/beta family, beta-barrel domain	ATP synthase subunit beta, mitochondrial OS=Drosophila melanogaster OX=7227 GN=ATPsynbeta PE=1 SV=3	C	Energy production and conversion	putative F0F1-type ATP synthase beta subunit-like protein [Dinothrombium tinctorium]	molecular function: binding (GO:0005488);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; biological process: single-organism process (GO:0044699);; biological process: localization (GO:0051179);; cellular component: cell (GO:0005623);; cellular component: membrane (GO:0016020);; cellular component: macromolecular complex (GO:0032991);; cellular component: membrane part (GO:0044425);; cellular component: cell part (GO:0044464);; molecular function: catalytic activity (GO:0003824);; molecular function: transporter activity (GO:0005215)	Oxidative phosphorylation (ko00190)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN2505_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	87.47	70.33	2.38	28.79	24.95	11.85	1.16535134379405e-06	12.5939990282411	up	6.34071238159268e-15	12.1107079537544	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN25492_c0_g1	--	0.92	0.00	0.00	0.00	0.00	0.00	2023.26	1265.89	220.57	457.95	802.90	398.94	3.1226630603301e-13	11.3489851157647	up	5.56773758537284e-16	12.2955173170993	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN25517_c0_g1	--	0.00	0.00	0.00	6.93	0.29	0.25	127.14	434.52	191.98	31.44	38.57	69.15	3.59213185087985e-15	12.0881389990399	up	2.56786980510447e-06	4.9497632787343	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN2575_c0_g1	--	0.00	0.00	0.10	0.02	0.02	0.00	137.59	147.98	2.86	82.89	64.20	15.74	1.66228265417111e-14	13.4261687750703	up	1.1004360999559e-17	12.515809232923	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN2602_c0_g1	--	0.00	0.03	0.00	0.00	0.00	0.00	62.34	60.65	3.26	41.52	37.83	8.38	2.51039096731435e-11	11.4641878976884	up	5.9208915634077e-14	12.4654308617621	up	[G]	Carbohydrate transport and metabolism 	Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553);; Biological Process: carbohydrate metabolic process (GO:0005975);; Molecular Function: chitin binding (GO:0008061);; 	K01183|1.7e-21|dpx:DAPPUDRAFT_315267|K01183 chitinase [EC:3.2.1.14] | (RefSeq) hypothetical protein	[G]	Carbohydrate transport and metabolism 	Glycosyl hydrolases family 18	Probable endochitinase OS=Caenorhabditis elegans OX=6239 GN=cht-1 PE=1 SV=1	G	Carbohydrate transport and metabolism	uncharacterized protein LOC8051405 [Ixodes scapularis]	molecular function: catalytic activity (GO:0003824);; biological process: metabolic process (GO:0008152);; molecular function: binding (GO:0005488)	Amino sugar and nucleotide sugar metabolism (ko00520)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN26537_c0_g3	--	0.00	0.00	0.00	0.00	0.00	0.00	83.29	59.73	2.85	46.33	37.45	7.33	3.65851571225931e-13	12.3343638822552	up	8.15121685200419e-14	12.5294490531189	up	--	--	--	--	--	--	Glucanosyltransferase;; Cellulase (glycosyl hydrolase family 5)	--	--	--	hypothetical protein PROFUN_10781 [Planoprotostelium fungivorum]	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN2746_c1_g1	--	0.00	0.08	0.00	0.00	0.05	0.00	0.86	17.51	5.61	15.15	18.71	51.80	0.006822639486704	8.0505147347888	up	6.51232797149628e-17	10.9056102466873	up	--	--	--	--	--	--	--	--	--	--	--	--	--	1	p1	(T)11	11	1299	1309	TCTTTACAGGGTCTGTGCCC	60.111	20	TTAGCTAGCCCCTAATCCCC	59.550	20	192	1162	1353	GGTCTGTGCCCCACATAAAC	60.240	20	TTAGCTAGCCCCTAATCCCC	59.550	20	183	1171	1353	TCTGTGCCCCACATAAACTG	59.566	20	TTAGCTAGCCCCTAATCCCC	59.550	20	181	1173	1353
TRINITY_DN2816_c0_g4	--	0.00	0.00	0.03	0.00	0.00	0.00	25.61	9.33	0.75	4.33	7.35	1.61	1.24171179874206e-08	9.78751772939134	up	2.8894752731012e-10	10.2654400884503	up	[C]	Energy production and conversion 	Molecular Function: oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620);; 	K07249|7.3e-131|npr:108790072|K07249 retinal dehydrogenase [EC:1.2.1.36] | (RefSeq) ALDH1A3; aldehyde dehydrogenase family 1 member A3 isoform X1	[C]	Energy production and conversion 	Aldehyde dehydrogenase family	Aldehyde dehydrogenase OS=Enchytraeus buchholzi OX=34589 GN=ALDH PE=2 SV=1	C	Energy production and conversion	hypothetical protein PROFUN_10810 [Planoprotostelium fungivorum]	biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699);; molecular function: catalytic activity (GO:0003824)	Retinol metabolism (ko00830)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN2877_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	22.21	14.93	1.69	14.89	18.21	4.26	1.22089895078806e-08	9.46672072101386	up	2.42028561790513e-10	10.2936039209787	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02868|1.3e-71|cbr:CBG14053|K02868 large subunit ribosomal protein L11e | (RefSeq) Cbr-rpl-11.2; C. briggsae CBR-RPL-11.2 protein	[J]	Translation, ribosomal structure and biogenesis 	ribosomal L5P family C-terminus;; Ribosomal protein L5	60S ribosomal protein L11-2 OS=Caenorhabditis briggsae OX=6238 GN=rpl-11.2 PE=3 SV=1	J	Translation, ribosomal structure and biogenesis	unnamed protein product [Toxocara canis]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN29705_c0_g1	--	0.00	0.03	0.00	0.00	0.00	0.00	30.73	14.55	0.61	13.38	9.93	2.81	2.2768720996889e-09	10.4694775900421	up	1.67431441145002e-12	11.6560279071662	up	--	--	--	--	--	--	fungal STAND N-terminal Goodbye domain;; Tetratricopeptide repeat;; NACHT domain;; Tetratricopeptide repeat	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN3032_c0_g3	--	0.00	0.00	0.00	0.00	0.00	0.00	123.14	47.26	9.58	36.05	42.75	16.78	6.30889588075661e-09	9.70164299290113	up	3.4630823787657e-10	9.78987072214225	up	--	--	Cellular Component: mitochondrion (GO:0005739);; 	--	--	--	--	--	--	--	hypothetical protein PBRA_004227 [Plasmodiophora brassicae]	cellular component: cell (GO:0005623);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN3048_c0_g1	--	0.00	0.00	0.00	0.00	0.03	0.00	54.70	31.79	0.82	20.91	14.79	6.18	1.34274350104138e-05	12.1790502838851	up	3.10504858365844e-12	11.0123768068139	up	[G]	Carbohydrate transport and metabolism 	Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553);; Biological Process: carbohydrate metabolic process (GO:0005975);; Molecular Function: chitin binding (GO:0008061);; 	K01183|8.7e-42|tnl:113492211|K01183 chitinase [EC:3.2.1.14] | (RefSeq) probable chitinase 10	[G]	Carbohydrate transport and metabolism 	Glycosyl hydrolases family 18	Putative chitinase 1 OS=Margaritifera margaritifera OX=102329 PE=1 SV=1	J	Translation, ribosomal structure and biogenesis	hypothetical protein FGO68_gene4091 [Halteria grandinella]	molecular function: catalytic activity (GO:0003824);; biological process: metabolic process (GO:0008152);; molecular function: binding (GO:0005488)	Amino sugar and nucleotide sugar metabolism (ko00520)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN30617_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	51.32	17.08	0.84	18.80	17.90	4.65	2.37436617933732e-05	11.62908331561	up	3.37918580582601e-13	11.8389928784962	up	--	--	Molecular Function: heme oxygenase (decyclizing) activity (GO:0004392);; Biological Process: heme oxidation (GO:0006788);; Biological Process: oxidation-reduction process (GO:0055114);; 	--	--	--	Heme oxygenase	--	--	--	--	biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699);; molecular function: catalytic activity (GO:0003824);; biological process: cellular process (GO:0009987)	--	1	p3	(CGC)5	15	740	754	TTGCCTTTGAGGAGCTATGG	60.344	20	ACCATCCGGTAAGAGAGGCT	60.096	20	270	591	860	CACCTCGGACGAGAGCTTAT	59.454	20	ACCATCCGGTAAGAGAGGCT	60.096	20	212	649	860	ATTGCCCCTGTTTACATTGC	59.829	20	TAAGAGAGGCTATGTCGGCG	60.502	20	277	575	851
TRINITY_DN3184_c0_g3	--	0.00	0.00	0.00	0.00	0.00	0.00	34.84	28.01	0.57	5.23	7.04	2.75	3.36727824365321e-05	11.8599269308887	up	1.26904913126289e-11	10.5778117141351	up	[O]	Posttranslational modification, protein turnover, chaperones 	Molecular Function: ATP binding (GO:0005524);; Biological Process: protein folding (GO:0006457);; Molecular Function: unfolded protein binding (GO:0051082);; 	K04079|4.5e-246|pki:111852409|K04079 molecular chaperone HtpG | (RefSeq) heat shock protein HSP 90-alpha-like isoform X1	[O]	Posttranslational modification, protein turnover, chaperones 	Hsp90 protein;; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase;; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	Heat shock-like 85 kDa protein OS=Trypanosoma cruzi OX=5693 PE=3 SV=1	O	Posttranslational modification, protein turnover, chaperones	heat shock protein 90-2, partial [Laodelphax striatellus]	molecular function: binding (GO:0005488);; biological process: cellular process (GO:0009987)	Protein processing in endoplasmic reticulum (ko04141);; Necroptosis (ko04217);; NOD-like receptor signaling pathway (ko04621);; Progesterone-mediated oocyte maturation (ko04914);; Salmonella infection (ko05132)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN32995_c0_g2	--	1.27	16.95	1.06	196.54	1.81	2.99	0.66	0.52	0.63	0.19	0.39	1.11	0.0064986082914941	-3.61618243114178	down	2.4566524189191e-05	-6.27767692416563	down	--	--	--	--	--	--	--	--	--	--	unnamed protein product [Leptidea sinapis]	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN33311_c0_g1	--	0.00	0.00	0.00	0.55	0.00	0.22	2909.94	233.28	14.03	575.62	226.37	37.15	1.89249398059316e-05	13.9452188057456	up	1.46151729029861e-13	10.903085276946	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN33448_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	479.98	59.37	2.47	116.10	62.22	13.27	0.000110736273089745	12.6400092725346	up	6.94530551046781e-13	12.2499315824896	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN33985_c0_g1	H696_02569	0.00	0.04	0.00	0.00	0.00	0.00	85.37	23.02	1.12	8.28	9.75	3.10	5.76680192337206e-10	11.039012578371	up	2.90685037665616e-11	10.5888546312855	up	[O]	Posttranslational modification, protein turnover, chaperones 	Molecular Function: protein disulfide isomerase activity (GO:0003756);; Biological Process: cell redox homeostasis (GO:0045454);; 	K08056|2.6e-81|sdu:111229821|K08056 protein disulfide-isomerase A3 [EC:5.3.4.1] | (RefSeq) pdia3; protein disulfide-isomerase A3	[O]	Posttranslational modification, protein turnover, chaperones 	Thioredoxin;; Thioredoxin-like domain;; Calsequestrin;; OST3 / OST6 family, transporter family;; Thioredoxin-like;; Thioredoxin-like;; Thioredoxin-like domain;; AhpC/TSA family	Protein disulfide-isomerase 2 OS=Dictyostelium discoideum OX=44689 GN=pdi2 PE=3 SV=1	O	Posttranslational modification, protein turnover, chaperones	hypothetical protein H696_02569 [Fonticula alba]	molecular function: catalytic activity (GO:0003824);; biological process: cellular process (GO:0009987);; biological process: single-organism process (GO:0044699);; biological process: biological regulation (GO:0065007)	Protein processing in endoplasmic reticulum (ko04141);; Herpes simplex virus 1 infection (ko05168)	1	p3	(CGT)5	15	1209	1223	TCAGGAGAAGAAGCTCAGCC	59.827	20	CCTTGTCCTTGAACTCGCTC	59.989	20	278	1094	1371	ATTGAGCCCAGCATCAAGTC	60.226	20	CCTTGTCCTTGAACTCGCTC	59.989	20	214	1158	1371	AGAAGAAGCTCAGCCACGAC	59.751	20	CCTTGTCCTTGAACTCGCTC	59.989	20	273	1099	1371
TRINITY_DN339_c0_g2	MONBRDRAFT_38123	0.00	0.00	0.00	0.00	0.00	0.00	34.57	17.75	0.76	8.84	10.14	3.09	3.0501896974681e-06	12.1778555944271	up	1.48224560440753e-13	11.7901760530888	up	[I]	Lipid transport and metabolism 	Molecular Function: protein binding (GO:0005515);; Biological Process: lipid metabolic process (GO:0006629);; 	--	[I]	Lipid transport and metabolism 	Leucine Rich repeat	--	G	Carbohydrate transport and metabolism	uncharacterized protein MONBRDRAFT_38123 [Monosiga brevicollis MX1]	molecular function: binding (GO:0005488);; biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN33_c2_g1	LOC115620051	0.00	0.00	0.00	0.00	0.00	0.00	5.29	3.69	0.64	2.35	3.50	0.90	1.53546445761118e-08	9.15791993699943	up	3.41613537017149e-09	9.48697485374723	up	--	--	Molecular Function: aspartic-type endopeptidase activity (GO:0004190);; 	K06002|3.0e-19|ipu:108265567|K06002 pepsin A [EC:3.4.23.1] | (RefSeq) pepsin A-like	[O]	Posttranslational modification, protein turnover, chaperones 	Eukaryotic aspartyl protease;; Xylanase inhibitor N-terminal;; Aspartyl protease	Aspartic protease 1 OS=Caenorhabditis elegans OX=6239 GN=asp-1 PE=1 SV=1	O	Posttranslational modification, protein turnover, chaperones	lysosomal aspartic protease [Scaptodrosophila lebanonensis]	biological process: metabolic process (GO:0008152);; molecular function: catalytic activity (GO:0003824)	--	1	p1	(G)11	11	2209	2219	CAGCATCAAACAGGACGAGA	59.984	20	GGGTCTTGGATTTTGAAGCA	60.051	20	280	2075	2354	ATCAAACAGGACGAGATGGG	59.927	20	GGGTCTTGGATTTTGAAGCA	60.051	20	276	2079	2354	AACAGGACGAGATGGGACTG	60.112	20	GGGTCTTGGATTTTGAAGCA	60.051	20	272	2083	2354
TRINITY_DN3445_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	71.45	48.89	1.28	14.47	21.84	7.39	7.68422923062619e-06	12.2875774734547	up	1.46151729029861e-13	11.646468181636	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN3488_c1_g1	LOC111356216	0.74	1.19	0.68	6.13	1.20	0.99	282.52	300.87	299.40	55.86	7.91	117.67	1.75050094162538e-43	8.09306755894367	up	3.16320263737231e-05	4.51021781897596	up	[G]	Carbohydrate transport and metabolism 	Cellular Component: integral component of membrane (GO:0016021);; Molecular Function: transmembrane transporter activity (GO:0022857);; Biological Process: transmembrane transport (GO:0055085);; 	K06258|2.5e-117|bmor:101744605|K06258 MFS transporter, VNT family, synaptic vesicle glycoprotein 2 | (RefSeq) synaptic vesicle glycoprotein 2B-like	[R]	General function prediction only 	Major Facilitator Superfamily;; Sugar (and other) transporter	--	S	Function unknown	synaptic vesicle glycoprotein 2C-like [Spodoptera litura]	cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425);; biological process: localization (GO:0051179);; molecular function: transporter activity (GO:0005215)	ECM-receptor interaction (ko04512)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN3489_c0_g1	LOC117985037	0.73	92.36	1.21	402.93	1.82	1.23	2.01	0.26	0.64	0.41	0.19	0.64	0.000529760681292063	-5.69214281257859	down	1.26792531938824e-06	-7.81793483479406	down	[E]	Amino acid transport and metabolism 	Molecular Function: serine-type carboxypeptidase activity (GO:0004185);; Cellular Component: integral component of membrane (GO:0016021);; 	K09645|7.5e-158|pxy:105386923|K09645 vitellogenic carboxypeptidase-like protein [EC:3.4.16.-] | (RefSeq) venom serine carboxypeptidase-like	[OE]	--	Serine carboxypeptidase	Venom serine carboxypeptidase OS=Apis mellifera OX=7460 PE=2 SV=1	--	--	venom serine carboxypeptidase-like [Aphantopus hyperantus]	biological process: metabolic process (GO:0008152);; molecular function: catalytic activity (GO:0003824);; cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN3512_c0_g1	--	1.91	0.66	1.38	0.25	1.00	1.75	18.87	49.82	10.56	2.47	16.60	10.72	8.68856411915831e-06	4.09259189658702	up	0.00250880297687544	3.57260581469829	up	--	--	Molecular Function: molecular_function (GO:0003674);; Molecular Function: structural molecule activity (GO:0005198);; Molecular Function: structural constituent of chitin-based cuticle (GO:0005214);; Cellular Component: cellular_component (GO:0005575);; Cellular Component: extracellular region (GO:0005576);; Biological Process: multicellular organism development (GO:0007275);; Molecular Function: structural constituent of chitin-based larval cuticle (GO:0008010);; Biological Process: biological_process (GO:0008150);; Cellular Component: extracellular matrix (GO:0031012);; Biological Process: multicellular organismal process (GO:0032501);; Biological Process: developmental process (GO:0032502);; Biological Process: chitin-based cuticle development (GO:0040003);; Molecular Function: structural constituent of cuticle (GO:0042302);; Biological Process: cuticle development (GO:0042335);; Cellular Component: obsolete extracellular region part (GO:0044421);; Biological Process: anatomical structure development (GO:0048856);; 	--	--	--	Insect cuticle protein	--	S	Function unknown	Flexible cuticle protein 12 [Eumeta japonica]	molecular function: structural molecule activity (GO:0005198);; cellular component: extracellular region (GO:0005576);; biological process: multicellular organismal process (GO:0032501);; biological process: developmental process (GO:0032502);; biological process: single-organism process (GO:0044699);; cellular component: extracellular region part (GO:0044421)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN35377_c0_g1	--	0.00	0.00	3.42	0.00	0.00	0.45	137.42	28.90	50.05	10.21	9.47	91.64	4.3941795312007e-06	5.4255705522115	up	3.56532267170598e-06	7.81453458913763	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN35882_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	41.53	22.00	5.85	34.16	37.86	7.01	8.71764808310198e-08	8.61345549042569	up	3.25309826862743e-09	9.79016120428411	up	--	--	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02924|4.7e-15|isc:IscW_ISCW015391|K02924 large subunit ribosomal protein L39e | (RefSeq) ribosomal protein L39, putative	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal L39 protein	60S ribosomal protein L39 OS=Drosophila melanogaster OX=7227 GN=RpL39 PE=1 SV=2	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L39 [Caligus rogercresseyi]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN3604_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	10.76	10.96	0.91	5.76	8.51	1.17	4.36188643700236e-09	9.82320872832263	up	1.94060329338237e-09	10.108530405284	up	--	--	Biological Process: single strand break repair (GO:0000012);; Biological Process: response to reactive oxygen species (GO:0000302);; Biological Process: RNA splicing, via transesterification reactions (GO:0000375);; Biological Process: RNA splicing, via transesterification reactions with bulged adenosine as nucleophile (GO:0000377);; Biological Process: mRNA splicing, via spliceosome (GO:0000398);; Cellular Component: chromatin (GO:0000785);; Molecular Function: molecular_function (GO:0003674);; Molecular Function: nucleic acid binding (GO:0003676);; Molecular Function: DNA binding (GO:0003677);; Molecular Function: chromatin binding (GO:0003682);; Molecular Function: damaged DNA binding (GO:0003684);; Molecular Function: double-stranded DNA binding (GO:0003690);; Molecular Function: RNA binding (GO:0003723);; Molecular Function: double-stranded RNA binding (GO:0003725);; Molecular Function: catalytic activity (GO:0003824);; Molecular Function: nuclease activity (GO:0004518);; Molecular Function: exonuclease activity (GO:0004527);; Molecular Function: exodeoxyribonuclease activity (GO:0004529);; Molecular Function: deoxyribonuclease activity (GO:0004536);; Molecular Function: binding (GO:0005488);; Molecular Function: protein binding (GO:0005515);; Cellular Component: cellular_component (GO:0005575);; Cellular Component: intracellular (GO:0005622);; Cellular Component: obsolete cell (GO:0005623);; Cellular Component: nucleus (GO:0005634);; Cellular Component: nucleoplasm (GO:0005654);; Cellular Component: chromosome (GO:0005694);; Cellular Component: nucleolus (GO:0005730);; Biological Process: nucleobase-containing compound metabolic process (GO:0006139);; Biological Process: DNA metabolic process (GO:0006259);; Biological Process: DNA ligation (GO:0006266);; Biological Process: DNA repair (GO:0006281);; Biological Process: double-strand break repair (GO:0006302);; Biological Process: RNA processing (GO:0006396);; Biological Process: mRNA processing (GO:0006397);; Biological Process: cellular aromatic compound metabolic process (GO:0006725);; Biological Process: phosphorus metabolic process (GO:0006793);; Biological Process: phosphate-containing compound metabolic process (GO:0006796);; Biological Process: nitrogen compound metabolic process (GO:0006807);; Biological Process: response to stress (GO:0006950);; Biological Process: cellular response to DNA damage stimulus (GO:0006974);; Biological Process: response to oxidative stress (GO:0006979);; Biological Process: biological_process (GO:0008150);; Biological Process: metabolic process (GO:0008152);; Biological Process: RNA splicing (GO:0008380);; Molecular Function: 5'-3' exonuclease activity (GO:0008409);; Molecular Function: phosphoglycolate phosphatase activity (GO:0008967);; Biological Process: response to toxic substance (GO:0009636);; Biological Process: cellular process (GO:0009987);; Biological Process: response to inorganic substance (GO:0010035);; Biological Process: gene expression (GO:0010467);; Biological Process: RNA metabolic process (GO:0016070);; Biological Process: mRNA metabolic process (GO:0016071);; Biological Process: dephosphorylation (GO:0016311);; Molecular Function: hydrolase activity (GO:0016787);; Molecular Function: hydrolase activity, acting on ester bonds (GO:0016788);; Molecular Function: phosphatase activity (GO:0016791);; Molecular Function: exonuclease activity, active with either ribo- or deoxyribonucleic acids and producing 5'-phosphomonoesters (GO:0016796);; Molecular Function: exodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016895);; Biological Process: regulation of protein stability (GO:0031647);; Cellular Component: membrane-enclosed lumen (GO:0031974);; Cellular Component: nuclear lumen (GO:0031981);; Biological Process: cellular response to stress (GO:0033554);; Molecular Function: DNA 5'-adenosine monophosphate hydrolase activity (GO:0033699);; Biological Process: cellular nitrogen compound metabolic process (GO:0034641);; Molecular Function: 5'-3' exodeoxyribonuclease activity (GO:0035312);; Biological Process: response to chemical (GO:0042221);; Biological Process: response to drug (GO:0042493);; Biological Process: response to hydrogen peroxide (GO:0042542);; Molecular Function: phosphoric ester hydrolase activity (GO:0042578);; Molecular Function: ion binding (GO:0043167);; Molecular Function: cation binding (GO:0043169);; Biological Process: macromolecule metabolic process (GO:0043170);; Cellular Component: organelle (GO:0043226);; Cellular Component: membrane-bounded organelle (GO:0043227);; Cellular Component: non-membrane-bounded organelle (GO:0043228);; Cellular Component: intracellular organelle (GO:0043229);; Cellular Component: intracellular membrane-bounded organelle (GO:0043231);; Cellular Component: intracellular non-membrane-bounded organelle (GO:0043232);; Cellular Component: organelle lumen (GO:0043233);; Biological Process: cellular metabolic process (GO:0044237);; Biological Process: primary metabolic process (GO:0044238);; Biological Process: cellular macromolecule metabolic process (GO:0044260);; Cellular Component: obsolete organelle part (GO:0044422);; Cellular Component: obsolete intracellular part (GO:0044424);; Cellular Component: obsolete chromosomal part (GO:0044427);; Cellular Component: obsolete nuclear part (GO:0044428);; Cellular Component: obsolete intracellular organelle part (GO:0044446);; Cellular Component: obsolete cell part (GO:0044464);; Molecular Function: polynucleotide 3'-phosphatase activity (GO:0046403);; Biological Process: heterocycle metabolic process (GO:0046483);; Biological Process: response to antibiotic (GO:0046677);; Molecular Function: metal ion binding (GO:0046872);; Molecular Function: protein N-terminus binding (GO:0047485);; Biological Process: response to stimulus (GO:0050896);; Molecular Function: phosphoprotein binding (GO:0051219);; Biological Process: cellular response to stimulus (GO:0051716);; Biological Process: biological regulation (GO:0065007);; Biological Process: regulation of biological quality (GO:0065008);; Cellular Component: intracellular organelle lumen (GO:0070013);; Biological Process: organic substance metabolic process (GO:0071704);; Biological Process: nucleic acid metabolic process (GO:0090304);; Biological Process: nucleic acid phosphodiester bond hydrolysis (GO:0090305);; Molecular Function: organic cyclic compound binding (GO:0097159);; Biological Process: polynucleotide dephosphorylation (GO:0098501);; Biological Process: polynucleotide 3' dephosphorylation (GO:0098506);; Molecular Function: polynucleotide phosphatase activity (GO:0098518);; Molecular Function: catalytic activity, acting on DNA (GO:0140097);; Biological Process: organic cyclic compound metabolic process (GO:1901360);; Molecular Function: heterocyclic compound binding (GO:1901363);; Biological Process: response to oxygen-containing compound (GO:1901700);; 	K10863|1.9e-12|ovi:T265_08155|K10863 aprataxin [EC:3.6.1.70 3.6.1.71 3.6.1.72] | (RefSeq) hypothetical protein	[R]	General function prediction only 	AT hook motif;; C2HE / C2H2 / C2HC zinc-binding finger;; Scavenger mRNA decapping enzyme C-term binding;; HIT domain	Aprataxin OS=Ciona intestinalis OX=7719 GN=APTX PE=2 SV=1	L	Replication, recombination and repair	aprataxin-like protein [Perkinsus olseni]	biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; biological process: response to stimulus (GO:0050896);; cellular component: cell (GO:0005623);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464);; molecular function: binding (GO:0005488);; molecular function: catalytic activity (GO:0003824);; cellular component: membrane-enclosed lumen (GO:0031974);; biological process: biological regulation (GO:0065007)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN36930_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	21.44	13.33	1.64	13.97	15.01	4.15	4.08674902215611e-09	9.82083911380658	up	5.40895723954735e-11	10.5377277887207	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02866|8.7e-45|nve:5520614|K02866 large subunit ribosomal protein L10e | (RefSeq) 60S ribosomal protein L10	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L16p/L10e;; Ribosomal protein L7Ae/L30e/S12e/Gadd45 family	60S ribosomal protein L10 OS=Bombyx mandarina OX=7092 GN=RpL10 PE=2 SV=1	J	Translation, ribosomal structure and biogenesis	putative ribosomal protein L10 [Barentsia elongata]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN37313_c0_g1	--	0.11	0.00	0.00	0.00	0.00	0.00	104.93	27.90	1.02	93.61	28.75	4.82	0.000337968628477944	9.67300503408948	up	2.53277251217859e-12	12.6802666187951	up	--	--	--	--	--	--	--	--	--	--	--	--	--	1	p3	(GTG)5	15	322	336	CGGTGAGCCTAACAAGAAGC	60.015	20	GGCCGGATATGGAATCTTTT	60.116	20	271	144	414	CCCGGTGATCCTAACAAGAA	59.926	20	GGCCGGATATGGAATCTTTT	60.116	20	247	168	414	CGGTGAGCCTGAGAAGAAAG	60.126	20	GGCCGGATATGGAATCTTTT	60.116	20	218	197	414
TRINITY_DN3783_c0_g1	--	0.00	0.00	0.02	0.00	0.00	0.00	57.01	15.04	0.67	8.68	8.33	2.63	5.76680192337206e-10	11.1245265145832	up	3.54923069743924e-12	11.1281698949144	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN38380_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	58.28	49.35	6.42	36.70	42.95	11.57	1.26281737363555e-08	9.28573522182003	up	7.08403753823095e-10	9.8980036539205	up	--	--	Cellular Component: ribosome (GO:0005840);; 	K02975|6.8e-19|nve:5507075|K02975 small subunit ribosomal protein S25e | (RefSeq) 40S ribosomal protein S25	[J]	Translation, ribosomal structure and biogenesis 	S25 ribosomal protein	40S ribosomal protein S25 OS=Branchiostoma belcheri OX=7741 GN=RPS25 PE=2 SV=1	J	Translation, ribosomal structure and biogenesis	hypothetical protein evm_011425 [Chilo suppressalis]	cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN39117_c0_g2	LOC110829307	0.00	0.00	0.04	0.00	0.00	0.00	52.70	40.34	2.01	21.35	32.12	8.18	5.5348033792161e-10	10.6106846541668	up	2.49354190792523e-13	11.7936762108117	up	[ER]	--	Molecular Function: zinc ion binding (GO:0008270);; Molecular Function: oxidoreductase activity (GO:0016491);; 	K17818|8.7e-43|tnl:113498593|K17818 D-arabinitol dehydrogenase (NADP+) [EC:1.1.1.287] | (RefSeq) D-arabinitol dehydrogenase 1-like	[Q]	Secondary metabolites biosynthesis, transport and catabolism 	Alcohol dehydrogenase GroES-like domain;; Zinc-binding dehydrogenase;; Glucose dehydrogenase C-terminus;; Zinc-binding dehydrogenase	Alcohol dehydrogenase 1 OS=Caenorhabditis elegans OX=6239 GN=sodh-1 PE=2 SV=2	Q	Secondary metabolites biosynthesis, transport and catabolism	D-arabinitol dehydrogenase 1-like isoform X1 [Zootermopsis nevadensis]	molecular function: binding (GO:0005488);; biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699);; molecular function: catalytic activity (GO:0003824)	Pentose and glucuronate interconversions (ko00040)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN3969_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	18.10	13.34	9.21	9.42	14.59	2.83	7.88336594269975e-10	10.5088576011969	up	1.32769221235661e-11	11.0707088344123	up	[I]	Lipid transport and metabolism 	Molecular Function: oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627);; Molecular Function: flavin adenine dinucleotide binding (GO:0050660);; 	K00249|6.6e-45|otw:112243609|K00249 acyl-CoA dehydrogenase [EC:1.3.8.7] | (RefSeq) acyl-CoA dehydrogenase apdG-like	[I]	Lipid transport and metabolism 	Acyl-CoA dehydrogenase, C-terminal domain;; Cytochrome b5-like Heme/Steroid binding domain;; Acyl-CoA dehydrogenase, middle domain;; Acyl-CoA dehydrogenase, N-terminal domain;; Acyl-CoA dehydrogenase, C-terminal domain;; Zinc knuckle;; Zinc knuckle;; Zinc knuckle;; Zinc knuckle	Isobutyryl-CoA dehydrogenase, mitochondrial OS=Dictyostelium discoideum OX=44689 GN=acad8 PE=3 SV=1	J	Translation, ribosomal structure and biogenesis	hypothetical protein PROFUN_10162 [Planoprotostelium fungivorum]	biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699);; molecular function: catalytic activity (GO:0003824);; molecular function: binding (GO:0005488)	Fatty acid degradation (ko00071);; Valine, leucine and isoleucine degradation (ko00280);; Fatty acid metabolism (ko01212);; PPAR signaling pathway (ko03320)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN3988_c0_g1	LOC116773695	0.71	10.92	0.92	103.53	32.53	4.47	1614.86	2131.55	1744.36	235.99	186.39	719.84	6.22843902609383e-19	8.60831288368759	up	0.00381508323023022	3.33979503754017	up	--	--	Cellular Component: cellular_component (GO:0005575);; Cellular Component: extracellular region (GO:0005576);; Cellular Component: extracellular space (GO:0005615);; Biological Process: antibacterial humoral response (GO:0019731);; Biological Process: defense response to bacterium (GO:0042742);; 	--	--	--	Attacin, C-terminal region	Attacin-A OS=Trichoplusia ni OX=7111 PE=3 SV=1	O	Posttranslational modification, protein turnover, chaperones	defense protein 3-like isoform X1 [Danaus plexippus plexippus]	cellular component: extracellular region (GO:0005576);; cellular component: extracellular region part (GO:0044421);; biological process: immune system process (GO:0002376);; biological process: response to stimulus (GO:0050896);; biological process: multi-organism process (GO:0051704)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN4072_c0_g1	LOC100377082	0.00	0.00	0.00	0.00	0.00	0.00	77.54	43.08	4.79	36.72	45.50	9.15	2.15099922958937e-09	9.94674854386938	up	1.85325888395742e-10	10.4665093763006	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02976|1.4e-31|csab:103234934|K02976 small subunit ribosomal protein S26e | (RefSeq) 40S ribosomal protein S26-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein S26e	40S ribosomal protein S26 OS=Octopus vulgaris OX=6645 GN=RPS26 PE=2 SV=1	J	Translation, ribosomal structure and biogenesis	PREDICTED: 40S ribosomal protein S26-like [Saccoglossus kowalevskii]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN40932_c0_g1	LOC110440730	0.00	0.00	0.00	0.00	0.00	0.00	69.66	41.50	2.26	21.22	37.32	7.67	2.01802595563089e-10	10.9711443674003	up	1.26904913126289e-11	11.1051705316053	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: cytoplasm (GO:0005737);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02984|2.1e-93|myi:110440730|K02984 small subunit ribosomal protein S3Ae | (RefSeq) 40S ribosomal protein S1-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal S3Ae family	40S ribosomal protein S3a OS=Nematostella vectensis OX=45351 GN=v1g242621 PE=3 SV=1	J	Translation, ribosomal structure and biogenesis	40S ribosomal protein S1-like [Mizuhopecten yessoensis]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: cell part (GO:0044464);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN41547_c0_g1	--	0.00	0.00	0.00	35.01	10.40	0.00	3105.12	1334.61	4566.53	317.10	292.62	853.66	3.12026731245871e-11	10.2573654838901	up	1.35141947251668e-07	6.19030203676726	up	--	--	Cellular Component: extracellular region (GO:0005576);; Biological Process: antibacterial humoral response (GO:0019731);; 	K20696|2.6e-09|bmor:101739536|K20696 cecropin | (RefSeq) cecropin-B	--	--	Cecropin family	Hyphancin-3F OS=Hyphantria cunea OX=39466 PE=3 SV=1	M	Cell wall/membrane/envelope biogenesis	unknown secreted protein [Papilio xuthus]	cellular component: extracellular region (GO:0005576);; biological process: immune system process (GO:0002376);; biological process: response to stimulus (GO:0050896);; biological process: multi-organism process (GO:0051704)	Toll and Imd signaling pathway (ko04624)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN4172_c0_g1	LOC111321301	0.00	0.00	0.00	0.00	0.00	0.00	36.70	14.54	1.51	6.44	18.13	4.90	1.47014216204526e-10	10.8615137996792	up	1.53980188661564e-11	10.9334913629674	up	[QV]	--	Molecular Function: monooxygenase activity (GO:0004497);; Molecular Function: iron ion binding (GO:0005506);; Cellular Component: integral component of membrane (GO:0016021);; Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705);; Molecular Function: heme binding (GO:0020037);; 	K07426|5.6e-25|crg:105327174|K07426 cytochrome P450 family 4 subfamily B polypeptide 1 [EC:1.14.14.1] | (RefSeq) cytochrome P450 4F22	[Q]	Secondary metabolites biosynthesis, transport and catabolism 	Cytochrome P450	Putative cytochrome P450 CYP13A3 OS=Caenorhabditis elegans OX=6239 GN=cyp-13A3 PE=3 SV=1	Q	Secondary metabolites biosynthesis, transport and catabolism	cytochrome P450 3A8-like [Stylophora pistillata]	biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699);; molecular function: catalytic activity (GO:0003824);; molecular function: binding (GO:0005488);; cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN42065_c0_g1	LOC114524758	0.00	0.00	0.00	0.00	0.00	0.00	48.26	40.37	2.60	31.84	34.21	8.42	6.23995163452286e-10	10.4993324760575	up	1.12973584826695e-11	11.0700387846345	up	--	--	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02917|1.8e-27|pdam:113676322|K02917 large subunit ribosomal protein L35Ae | (RefSeq) 60S ribosomal protein L35a-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L35Ae	60S ribosomal protein L35a OS=Caenorhabditis elegans OX=6239 GN=rpl-33 PE=1 SV=3	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L33-A-like [Dendronephthya gigantea]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN42116_c0_g1	ACA1_128450	0.00	0.00	0.00	0.00	0.00	0.00	31.65	21.15	1.47	11.29	17.12	3.28	5.5348033792161e-10	10.5623216873889	up	9.35090562815857e-11	10.6701658938049	up	--	--	Molecular Function: ATP transmembrane transporter activity (GO:0005347);; Cellular Component: mitochondrial inner membrane (GO:0005743);; Cellular Component: integral component of membrane (GO:0016021);; 	K05863|1.3e-98|lgi:LOTGIDRAFT_232343|K05863 solute carrier family 25 (mitochondrial adenine nucleotide translocator), member 4/5/6/31 | (RefSeq) hypothetical protein	[C]	Energy production and conversion 	Mitochondrial carrier protein	ADP,ATP carrier protein 1 OS=Anopheles gambiae OX=7165 GN=AGAP006782 PE=2 SV=2	C	Energy production and conversion	adenine nucleotide translocator, putative [Acanthamoeba castellanii str. Neff]	biological process: single-organism process (GO:0044699);; biological process: localization (GO:0051179);; molecular function: transporter activity (GO:0005215);; cellular component: cell (GO:0005623);; cellular component: membrane (GO:0016020);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464);; cellular component: membrane part (GO:0044425)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN42740_c0_g2	--	0.00	0.00	0.00	0.00	0.00	0.00	100.88	16.47	1.54	83.09	39.21	9.04	0.000174624840655474	10.9602876255121	up	1.23011115863239e-12	12.1553236788798	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN43645_c0_g1	ACA1_068750	0.00	0.00	0.00	0.00	0.00	0.00	36.96	25.61	3.36	13.37	27.45	5.12	8.46754903061081e-09	9.46235658190736	up	2.15823957448506e-09	9.85678542900421	up	--	--	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02918|1.9e-24|pmur:107296784|K02918 large subunit ribosomal protein L35e | (RefSeq) RPL35; 60S ribosomal protein L35	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal L29 protein	60S ribosomal protein L35 OS=Caenorhabditis elegans OX=6239 GN=rpl-35 PE=3 SV=1	J	Translation, ribosomal structure and biogenesis	ribosomal protein L35, putative [Acanthamoeba castellanii str. Neff]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN44398_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	110.47	87.99	3.33	59.22	39.08	12.87	1.09905413810996e-07	13.2579941243856	up	2.97502990634869e-16	13.2281426147881	up	[G]	Carbohydrate transport and metabolism 	Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553);; Cellular Component: cell wall (GO:0005618);; Biological Process: carbohydrate metabolic process (GO:0005975);; Biological Process: cell wall organization (GO:0071555);; 	--	--	--	Glycosyl hydrolases family 16	--	--	--	LOW QUALITY PROTEIN: probable glycosidase crf1, partial [Nilaparvata lugens]	molecular function: catalytic activity (GO:0003824);; cellular component: cell (GO:0005623);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; biological process: cellular component organization or biogenesis (GO:0071840)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN4452_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	28.29	31.12	1.06	3.68	7.12	2.41	3.49665783785343e-05	11.0092860050331	up	1.22484198881395e-09	9.58618980191326	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN46053_c0_g2	--	0.00	0.00	0.00	0.00	0.00	0.00	23.33	20.42	3.22	23.06	23.54	5.90	9.21555603351206e-09	9.28633133886591	up	2.25774078574648e-10	10.3058068248541	up	--	--	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02951|1.8e-39|hmg:100202980|K02951 small subunit ribosomal protein S12e | (RefSeq) 40S ribosomal protein S12-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L7Ae/L30e/S12e/Gadd45 family	40S ribosomal protein S12 OS=Caenorhabditis elegans OX=6239 GN=rps-12 PE=3 SV=2	J	Translation, ribosomal structure and biogenesis	TPA: putative 40S ribosomal protein S12 [Spadella cephaloptera]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN46350_c0_g1	rpl6	0.00	0.00	0.00	0.00	0.00	0.00	22.13	12.44	1.69	8.12	12.67	2.85	8.13694603310392e-09	9.53379607809605	up	1.53339019323101e-09	9.81616326196826	up	--	--	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02934|2.3e-32|pdam:113677190|K02934 large subunit ribosomal protein L6e | (RefSeq) 60S ribosomal protein L6-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L6e	60S ribosomal protein L6 OS=Dictyostelium discoideum OX=44689 GN=rpl6 PE=1 SV=1	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L6 [Dictyostelium discoideum AX4]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN46585_c0_g1	--	0.00	0.00	0.02	0.00	0.00	0.00	93.27	18.87	0.53	5.00	8.04	2.47	1.25757614044958e-05	11.5107176430996	up	2.69739380638679e-11	10.5965778011613	up	[O]	Posttranslational modification, protein turnover, chaperones 	Molecular Function: ATP binding (GO:0005524);; 	K09490|5.5e-249|amj:106737030|K09490 endoplasmic reticulum chaperone BiP [EC:3.6.4.10] | (RefSeq) HSPA5; heat shock protein family A (Hsp70) member 5	[O]	Posttranslational modification, protein turnover, chaperones 	Hsp70 protein;; MreB/Mbl protein;; NAD-specific glutamate dehydrogenase	Heat shock 70 kDa protein C OS=Caenorhabditis briggsae OX=6238 GN=hsp-3 PE=3 SV=2	O	Posttranslational modification, protein turnover, chaperones	heat shock protein cognate 70-3 [Laodelphax striatellus]	molecular function: binding (GO:0005488)	Protein export (ko03060);; Protein processing in endoplasmic reticulum (ko04141)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN46946_c0_g1	--	1.36	0.00	0.00	0.00	0.44	0.39	2735.57	1116.25	81.62	91.72	349.18	204.10	9.78453445366098e-15	10.9249764794297	up	4.33617991453361e-13	10.029058492251	up	--	--	--	--	--	--	Antifungal peptide	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN4760_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	1.86	2.15	1.63	4.83	6.79	0.84	4.24639244308369e-09	8.84602052755558	up	3.03239041278135e-10	10.7759217850089	up	[G]	Carbohydrate transport and metabolism 	Molecular Function: molecular_function (GO:0003674);; Molecular Function: catalytic activity (GO:0003824);; Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553);; Molecular Function: beta-galactosidase activity (GO:0004565);; Cellular Component: cellular_component (GO:0005575);; Cellular Component: intracellular (GO:0005622);; Cellular Component: obsolete cell (GO:0005623);; Cellular Component: cytoplasm (GO:0005737);; Cellular Component: vacuole (GO:0005773);; Biological Process: carbohydrate metabolic process (GO:0005975);; Molecular Function: galactosidase activity (GO:0015925);; Molecular Function: hydrolase activity (GO:0016787);; Molecular Function: hydrolase activity, acting on glycosyl bonds (GO:0016798);; Cellular Component: organelle (GO:0043226);; Cellular Component: membrane-bounded organelle (GO:0043227);; Cellular Component: intracellular organelle (GO:0043229);; Cellular Component: intracellular membrane-bounded organelle (GO:0043231);; Cellular Component: obsolete intracellular part (GO:0044424);; Cellular Component: obsolete cytoplasmic part (GO:0044444);; Cellular Component: obsolete cell part (GO:0044464);; 	K12309|1.2e-18|aag:5565066|K12309 beta-galactosidase [EC:3.2.1.23] | (RefSeq) beta-galactosidase isoform X1	[G]	Carbohydrate transport and metabolism 	Beta-galactosidase jelly roll domain;; Beta-galactosidase, domain 2;; Beta-galactosidase, domain 3;; Glycosyl hydrolases family 35	Probable beta-galactosidase 2 OS=Dictyostelium discoideum OX=44689 GN=glb2 PE=3 SV=1	G	Carbohydrate transport and metabolism	hypothetical protein PROFUN_11604 [Planoprotostelium fungivorum]	molecular function: catalytic activity (GO:0003824);; cellular component: cell (GO:0005623);; cellular component: cell part (GO:0044464);; cellular component: organelle (GO:0043226);; biological process: metabolic process (GO:0008152)	Galactose metabolism (ko00052);; Other glycan degradation (ko00511);; Glycosaminoglycan degradation (ko00531);; Sphingolipid metabolism (ko00600);; Glycosphingolipid biosynthesis - ganglio series (ko00604);; Lysosome (ko04142)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN47694_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	28.23	23.79	1.22	18.91	19.71	4.32	1.32801938446909e-09	10.4358421935333	up	2.53850138059264e-11	10.9770735975518	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Biological Process: translation (GO:0006412);; Cellular Component: large ribosomal subunit (GO:0015934);; 	K02872|6.4e-63|nve:5510328|K02872 large subunit ribosomal protein L13Ae | (RefSeq) 60S ribosomal protein L13a	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L13	60S ribosomal protein L13a OS=Drosophila melanogaster OX=7227 GN=RpL13A PE=1 SV=1	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L16 isoform X2 [Nilaparvata lugens]	molecular function: structural molecule activity (GO:0005198);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN47791_c0_g1	--	0.00	0.00	0.04	0.00	0.12	0.00	217.87	183.19	6.67	1.44	65.36	34.31	3.09609388106531e-14	12.8611276950577	up	1.69328617323787e-09	9.7846776573166	up	[EQ]	--	--	--	--	--	Peptidase family S58	--	Q	Secondary metabolites biosynthesis, transport and catabolism	hypothetical protein B566_EDAN000174 [Ephemera danica]	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN48087_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	190.67	81.58	2.45	41.65	50.65	17.07	2.12958607946278e-05	12.0328558456417	up	1.75244881909418e-13	11.634940399448	up	--	--	--	--	--	--	Beta-1,3-glucanase	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN48559_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	120.89	43.68	6.39	10.96	23.27	21.38	2.80630659277709e-09	9.94945300904624	up	6.69541178230555e-10	9.19804226274841	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN48742_c0_g1	--	0.17	0.00	0.00	0.18	0.00	0.00	444.41	235.51	30.37	74.12	136.72	54.06	5.94973297244494e-13	11.5654625500359	up	8.02488097213487e-13	11.0531139452093	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN49441_c0_g1	LOC110986689	0.00	0.00	0.00	0.00	0.00	0.00	35.18	18.37	2.82	20.61	24.88	5.47	3.0304604107219e-10	10.3103359972478	up	1.33964746897495e-11	11.0746843595023	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: RNA binding (GO:0003723);; Molecular Function: structural constituent of ribosome (GO:0003735);; Biological Process: translation (GO:0006412);; Cellular Component: cytosolic large ribosomal subunit (GO:0022625);; 	K02885|2.7e-60|aplc:110986689|K02885 large subunit ribosomal protein L19e | (RefSeq) 60S ribosomal protein L19-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L19e	60S ribosomal protein L19 OS=Drosophila melanogaster OX=7227 GN=RpL19 PE=1 SV=2	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L19-like [Acanthaster planci]	molecular function: binding (GO:0005488);; molecular function: structural molecule activity (GO:0005198);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN49524_c0_g1	LOC111335084	0.00	0.00	0.00	0.00	0.00	0.00	27.08	15.99	2.25	15.35	18.78	2.62	4.16557365065384e-09	9.66100785173719	up	1.15791916948576e-09	10.2826142540563	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02912|3.3e-38|spis:111335084|K02912 large subunit ribosomal protein L32e | (RefSeq) 60S ribosomal protein L32-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L32	60S ribosomal protein L32 OS=Spodoptera frugiperda OX=7108 GN=RpL32 PE=2 SV=1	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L32 [Stylophora pistillata]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN49571_c0_g1	--	0.05	0.00	0.00	0.00	0.00	0.00	60.78	18.07	1.09	7.88	13.28	3.88	4.16557365065384e-09	10.3330182011416	up	3.50660632041129e-11	10.5744086725799	up	[E]	Amino acid transport and metabolism 	Molecular Function: glutamate-ammonia ligase activity (GO:0004356);; Molecular Function: ATP binding (GO:0005524);; Biological Process: glutamine biosynthetic process (GO:0006542);; 	K01915|1.7e-126|pdam:113677116|K01915 glutamine synthetase [EC:6.3.1.2] | (RefSeq) glutamine synthetase-like	[E]	Amino acid transport and metabolism 	Glutamine synthetase, catalytic domain;; Glutamine synthetase, beta-Grasp domain	Glutamine synthetase OS=Panulirus argus OX=6737 PE=2 SV=1	E	Amino acid transport and metabolism	Glutamine synthetase [Pocillopora damicornis]	molecular function: catalytic activity (GO:0003824);; molecular function: binding (GO:0005488);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; biological process: single-organism process (GO:0044699)	Arginine biosynthesis (ko00220);; Alanine, aspartate and glutamate metabolism (ko00250);; Glyoxylate and dicarboxylate metabolism (ko00630);; Nitrogen metabolism (ko00910);; Biosynthesis of amino acids (ko01230)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN49730_c0_g1	LOC110846681	0.00	0.00	0.00	0.00	0.00	0.00	7.54	6.45	1.19	25.93	23.51	3.16	9.77511217047044e-08	8.67443901404193	up	3.78313064302947e-11	11.3277904838098	up	--	--	--	--	--	--	Protein of unknown function (DUF1479)	--	S	Function unknown	uncharacterized protein YbiU [Folsomia candida]	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN49999_c0_g1	LOC107042357	0.00	0.00	0.00	0.00	0.00	0.00	173.70	178.40	9.96	92.68	106.70	25.26	1.1503593464884e-12	11.9022951003631	up	1.19224145218671e-13	12.0788497838597	up	--	--	Cellular Component: nucleosome (GO:0000786);; Molecular Function: DNA binding (GO:0003677);; Cellular Component: nucleus (GO:0005634);; Molecular Function: protein heterodimerization activity (GO:0046982);; 	K11253|7.4e-61|mcal:110291881|K11253 histone H3 | (RefSeq) uncharacterized protein LOC110291881	[B]	Chromatin structure and dynamics 	Core histone H2A/H2B/H3/H4	Histone H3.3 OS=Trichinella pseudospiralis OX=6337 GN=HHT3 PE=2 SV=3	B	Chromatin structure and dynamics	histone H3.3 [Diachasma alloeum]	cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464);; molecular function: binding (GO:0005488)	Alcoholism (ko05034);; Transcriptional misregulation in cancer (ko05202);; Systemic lupus erythematosus (ko05322)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN49_c0_g1	--	0.06	0.00	0.00	0.21	0.05	0.00	1111.86	546.14	10.82	491.41	356.96	81.59	2.4772352439469e-16	14.3760886950321	up	1.58998788641047e-20	13.5805112795144	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN50155_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	185.62	105.12	18.30	67.05	62.10	14.60	2.86913571480723e-10	10.1599851241023	up	6.69541178230555e-10	10.0828353720555	up	--	--	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	--	--	--	--	--	--	--	--	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN50176_c0_g1	--	0.11	0.00	0.00	0.00	0.31	0.00	35.69	30.40	4.72	31.48	42.83	5.54	2.45044250788733e-08	8.97942161522174	up	1.05970102860258e-08	8.31419068329986	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Biological Process: translation (GO:0006412);; Cellular Component: small ribosomal subunit (GO:0015935);; Molecular Function: rRNA binding (GO:0019843);; 	K02997|3.6e-75|sanh:107672032|K02997 small subunit ribosomal protein S9e | (RefSeq) 40S ribosomal protein S9	[J]	Translation, ribosomal structure and biogenesis 	S4 domain;; Ribosomal protein S4/S9 N-terminal domain	40S ribosomal protein S9 OS=Drosophila melanogaster OX=7227 GN=RpS9 PE=1 SV=2	U	Intracellular trafficking, secretion, and vesicular transport	ribosomal protein S9 [Lysiphlebus testaceipes]	molecular function: structural molecule activity (GO:0005198);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464);; molecular function: binding (GO:0005488)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN50253_c0_g1	LOC5513420	0.09	0.00	0.00	0.00	0.00	0.00	29.82	26.08	2.31	17.53	21.77	6.44	5.85065333740225e-08	9.07085155776052	up	4.40822857464825e-11	10.5198261790433	up	--	--	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02873|5.6e-51|nve:5513420|K02873 large subunit ribosomal protein L13e | (RefSeq) 60S ribosomal protein L13	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L13e	60S ribosomal protein L13 OS=Dictyostelium discoideum OX=44689 GN=rpl13 PE=1 SV=1	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L13 [Nematostella vectensis]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN51174_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	13.24	6.70	2.91	88.68	17.60	2.88	9.27706613081698e-08	8.39716149865118	up	5.71949615855246e-10	11.5782166403559	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN51499_c0_g1	--	0.00	0.00	0.00	0.00	0.06	0.00	63.36	81.75	4.08	56.44	51.68	13.81	2.13468194547511e-12	11.858136077789	up	1.63511633294264e-12	11.3920965388562	up	--	--	--	--	--	--	Ser-Thr-rich glycosyl-phosphatidyl-inositol-anchored membrane family	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN51894_c0_g1	--	0.00	0.29	0.00	0.00	0.00	0.00	565.03	80.12	13.28	123.53	83.08	26.40	1.67736612524889e-09	10.5645488603909	up	8.18592407542709e-12	11.1436727933958	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN51964_c0_g1	LOC8035875	0.00	0.00	0.00	0.00	0.00	0.00	34.49	24.88	2.06	22.27	23.65	5.97	8.66831173896195e-09	9.70507849806646	up	1.77944792497726e-10	10.348931799891	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Biological Process: translation (GO:0006412);; Cellular Component: large ribosomal subunit (GO:0015934);; 	K02900|3.6e-38|isc:IscW_ISCW021749|K02900 large subunit ribosomal protein L27Ae | (RefSeq) ribosomal protein L27A, putative	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal proteins 50S-L15, 50S-L18e, 60S-L27A	60S ribosomal protein L27a OS=Drosophila melanogaster OX=7227 GN=RpL27A PE=1 SV=2	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L27a isoform X1 [Ixodes scapularis]	molecular function: structural molecule activity (GO:0005198);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN52587_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	27.72	12.70	1.62	16.51	19.35	5.05	7.88000336469847e-09	9.66459839122536	up	6.31609016164018e-11	10.5481127606041	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Biological Process: translation (GO:0006412);; Cellular Component: large ribosomal subunit (GO:0015934);; 	K02880|1.3e-53|lcm:102358720|K02880 large subunit ribosomal protein L17e | (RefSeq) RPL17; ribosomal protein L17	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L22p/L17e	60S ribosomal protein L17 OS=Diaphorina citri OX=121845 GN=RpL17 PE=2 SV=1	J	Translation, ribosomal structure and biogenesis	ribosomal protein l17 [Haliotis discus discus]	molecular function: structural molecule activity (GO:0005198);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN52642_c0_g1	LOC110440810	0.00	0.00	0.00	0.00	0.00	0.05	20.70	16.69	0.99	11.78	14.67	2.96	3.36192516317292e-09	10.1162240837404	up	2.78513883365453e-09	9.62639790372199	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02925|6.1e-160|myi:110440810|K02925 large subunit ribosomal protein L3e | (RefSeq) 60S ribosomal protein L3-B-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L3	60S ribosomal protein L3 OS=Drosophila melanogaster OX=7227 GN=RpL3 PE=1 SV=3	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L3-B-like [Mizuhopecten yessoensis]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN53218_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	33.42	29.21	5.21	42.04	41.77	8.06	4.71833767268866e-09	9.36736050627767	up	1.13951911334101e-10	10.6964785329357	up	--	--	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translational elongation (GO:0006414);; 	K02943|5.0e-22|tru:101075478|K02943 large subunit ribosomal protein LP2 | (RefSeq) rplp2; 60S acidic ribosomal protein P2	[J]	Translation, ribosomal structure and biogenesis 	60s Acidic ribosomal protein	60S acidic ribosomal protein P2 OS=Branchiostoma floridae OX=7739 PE=3 SV=1	J	Translation, ribosomal structure and biogenesis	60S acidic ribosomal protein P2 [Coptotermes formosanus]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN53229_c0_g1	LOC107371184	0.00	0.00	0.00	0.00	0.00	0.00	42.45	24.77	1.69	15.25	23.49	4.44	1.48174521982102e-09	10.3390356745469	up	1.38535789393974e-10	10.5798162069435	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: translation elongation factor activity (GO:0003746);; Molecular Function: ribosome binding (GO:0043022);; Biological Process: positive regulation of translational elongation (GO:0045901);; Biological Process: positive regulation of translational termination (GO:0045905);; 	K03263|4.0e-55|tut:107371184|K03263 translation initiation factor 5A | (RefSeq) eukaryotic translation initiation factor 5A-1	[J]	Translation, ribosomal structure and biogenesis 	Eukaryotic elongation factor 5A hypusine, DNA-binding OB fold	Eukaryotic translation initiation factor 5A OS=Spodoptera exigua OX=7107 GN=eIF-5A PE=2 SV=1	J	Translation, ribosomal structure and biogenesis	eukaryotic translation initiation factor 5A-1 [Tetranychus urticae]	biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; molecular function: binding (GO:0005488);; biological process: biological regulation (GO:0065007)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN5322_c0_g1	--	2.28	4.34	5.99	2.78	1.60	2.42	17.33	14.16	23.25	7.22	3.16	13.41	0.0094155294295109	1.9702907854442	up	0.00328657442403013	2.09915498299576	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN53284_c0_g1	--	0.00	0.06	0.00	0.00	0.00	0.00	28.04	11.96	1.82	9.64	17.68	5.84	7.5048167957862e-08	8.95579353580283	up	3.50660632041129e-11	10.4815020743854	up	[R]	General function prediction only 	Molecular Function: aminocarboxymuconate-semialdehyde decarboxylase activity (GO:0001760);; Cellular Component: cytosol (GO:0005829);; Molecular Function: hydrolase activity (GO:0016787);; Biological Process: negative regulation of quinolinate biosynthetic process (GO:1904985);; 	K03392|8.1e-23|hcq:109512303|K03392 aminocarboxymuconate-semialdehyde decarboxylase [EC:4.1.1.45] | (RefSeq) acmsd; 2-amino-3-carboxymuconate-6-semialdehyde decarboxylase isoform X1	--	--	Amidohydrolase	--	S	Function unknown	hypothetical protein FQR65_LT19926 [Abscondita terminalis]	molecular function: catalytic activity (GO:0003824);; cellular component: cell (GO:0005623);; cellular component: cell part (GO:0044464);; biological process: biological regulation (GO:0065007)	Tryptophan metabolism (ko00380)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN53378_c0_g1	LOC110239894	0.00	0.00	0.00	0.00	0.00	0.14	89.92	61.52	8.85	64.85	76.58	11.85	5.50623124395549e-11	10.5939780641388	up	2.21355674788366e-10	10.5026829966582	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: RNA binding (GO:0003723);; Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02964|3.3e-66|epa:110239894|K02964 small subunit ribosomal protein S18e | (RefSeq) 40S ribosomal protein S18	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein S13/S18	40S ribosomal protein S18 OS=Branchiostoma belcheri OX=7741 GN=RPS18 PE=2 SV=1	J	Translation, ribosomal structure and biogenesis	40S ribosomal protein S18 [Exaiptasia diaphana]	molecular function: binding (GO:0005488);; molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN5339_c0_g1	LOC108366698	0.00	0.00	0.00	0.00	0.00	0.00	12.76	7.37	0.56	4.40	3.13	1.42	1.8931552300226e-09	10.2298626374906	up	3.92999326977989e-10	9.8640003540338	up	[GEPR]	--	Cellular Component: integral component of membrane (GO:0016021);; Molecular Function: transmembrane transporter activity (GO:0022857);; 	K08144|1.6e-17|tmu:101345415|K08144 MFS transporter, SP family, solute carrier family 2 (facilitated glucose transporter), member 6 | (RefSeq) solute carrier family 2, facilitated glucose transporter member 6 isoform X2	[R]	General function prediction only 	Sugar (and other) transporter;; Major Facilitator Superfamily;; Sugar (and other) transporter;; Major Facilitator Superfamily	Facilitated trehalose transporter Tret1 OS=Apis mellifera ligustica OX=7469 GN=Tret1 PE=1 SV=1	U	Intracellular trafficking, secretion, and vesicular transport	PREDICTED: MFS glucose transporter mfs1-like [Rhagoletis zephyria]	cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425);; biological process: localization (GO:0051179);; molecular function: transporter activity (GO:0005215)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN53699_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	30.08	22.62	1.46	19.95	26.70	4.15	2.31190374959361e-09	10.1777682994161	up	5.76173057636066e-11	10.9730678540533	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: RNA binding (GO:0003723);; Molecular Function: structural constituent of ribosome (GO:0003735);; Biological Process: translation (GO:0006412);; Cellular Component: small ribosomal subunit (GO:0015935);; 	K02981|8.9e-85|tca:664315|K02981 small subunit ribosomal protein S2e | (RefSeq) 40S ribosomal protein S2	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein S5, N-terminal domain;; Ribosomal protein S5, C-terminal domain	40S ribosomal protein S2 OS=Drosophila melanogaster OX=7227 GN=RpS2 PE=1 SV=2	J	Translation, ribosomal structure and biogenesis	40S ribosomal protein S2-like [Nilaparvata lugens]	molecular function: binding (GO:0005488);; molecular function: structural molecule activity (GO:0005198);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN54156_c0_g1	--	0.11	0.00	0.00	0.00	0.10	0.00	887.31	125.36	15.24	130.51	23.74	68.91	3.1226630603301e-13	12.6978976968642	up	6.40738147764033e-13	11.4134659771082	up	--	--	--	--	--	--	Pathogen effector; putative necrosis-inducing factor	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN54163_c0_g1	ACA1_203760	0.00	0.00	0.00	0.00	0.00	0.00	29.27	23.04	2.00	21.31	27.45	4.76	8.79912023089063e-09	9.65514809540115	up	2.40688832758601e-10	10.5242517518643	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02894|1.2e-55|bta:504876|K02894 large subunit ribosomal protein L23e | (RefSeq) RPL23; 60S ribosomal protein L23	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein L14p/L23e	60S ribosomal protein L23 OS=Aedes aegypti OX=7159 GN=RpL23-A PE=2 SV=1	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L23, putative [Acanthamoeba castellanii str. Neff]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN54177_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	19.64	9.59	1.02	6.69	10.06	3.09	9.93921991170278e-09	9.67164843970298	up	3.4630823787657e-10	9.95278561865444	up	[I]	Lipid transport and metabolism 	Molecular Function: transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747);; 	K07513|8.3e-85|ncc:104959411|K07513 acetyl-CoA acyltransferase 1 [EC:2.3.1.16] | (RefSeq) acaa1; 3-ketoacyl-CoA thiolase, peroxisomal	[I]	Lipid transport and metabolism 	Thiolase, N-terminal domain;; Thiolase, C-terminal domain	Acetyl-CoA acetyltransferase homolog, mitochondrial OS=Caenorhabditis elegans OX=6239 GN=kat-1 PE=1 SV=2	I	Lipid transport and metabolism	3-ketoacyl-CoA thiolase A [Planoprotostelium fungivorum]	molecular function: catalytic activity (GO:0003824)	Fatty acid degradation (ko00071);; Valine, leucine and isoleucine degradation (ko00280);; alpha-Linolenic acid metabolism (ko00592);; Biosynthesis of unsaturated fatty acids (ko01040);; Fatty acid metabolism (ko01212);; PPAR signaling pathway (ko03320);; Peroxisome (ko04146)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN54273_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	73.21	70.60	3.73	24.27	39.15	11.96	3.1226630603301e-13	12.2480866746513	up	3.04751365339232e-14	12.077324143289	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN54322_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	91.57	89.51	3.95	37.62	68.17	13.72	9.05604460649468e-11	11.1471758299936	up	4.34654334525338e-12	11.38478388135	up	--	--	Cellular Component: nucleosome (GO:0000786);; Molecular Function: DNA binding (GO:0003677);; Cellular Component: nucleus (GO:0005634);; Molecular Function: protein heterodimerization activity (GO:0046982);; 	K11251|2.6e-51|clv:102089429|K11251 histone H2A | (RefSeq) LOW QUALITY PROTEIN: histone H2A	[B]	Chromatin structure and dynamics 	C-terminus of histone H2A;; Core histone H2A/H2B/H3/H4;; Histone-like transcription factor (CBF/NF-Y) and archaeal histone	Histone H2A OS=Caenorhabditis elegans OX=6239 GN=his-3 PE=1 SV=2	B	Chromatin structure and dynamics	hypothetical protein GE061_009080 [Apolygus lucorum]	cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464);; molecular function: binding (GO:0005488)	Necroptosis (ko04217)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN54387_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	9.30	9.69	0.52	8.03	5.95	1.47	6.56443519533428e-11	11.1243256714353	up	2.73855716564163e-12	11.5829160204505	up	[S]	Function unknown 	Molecular Function: carbon-sulfur lyase activity (GO:0016846);; 	--	--	--	Protein of unknown function (DUF1365);; Glutathione-dependent formaldehyde-activating enzyme	--	S	Function unknown	hypothetical protein PROFUN_16851, partial [Planoprotostelium fungivorum]	molecular function: catalytic activity (GO:0003824)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN54587_c0_g1	LOC110440701	0.00	0.00	0.08	0.00	0.00	0.00	23.38	16.47	1.70	11.25	19.14	3.65	6.03920792425055e-07	8.46047236905997	up	1.10622497261837e-09	10.0256863611116	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; 	K02877|1.2e-87|myi:110440701|K02877 large subunit ribosomal protein L15e | (RefSeq) 60S ribosomal protein L15-A-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal L15	60S ribosomal protein L15 OS=Hydra vulgaris OX=6087 GN=RPL15 PE=2 SV=2	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L15-A-like [Mizuhopecten yessoensis]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN54709_c0_g1	LOC100640221	0.00	0.00	0.00	0.00	0.00	0.00	2.10	37.53	3.93	3.00	21.03	7.03	0.000678267942835753	10.2779951198382	up	5.97227195191499e-10	10.3467964607727	up	[Q]	Secondary metabolites biosynthesis, transport and catabolism 	Molecular Function: ferric iron binding (GO:0008199);; Biological Process: catechol-containing compound metabolic process (GO:0009712);; Molecular Function: catechol 1,2-dioxygenase activity (GO:0018576);; 	--	--	--	Dioxygenase;; Catechol dioxygenase N terminus	--	E	Amino acid transport and metabolism	PREDICTED: uncharacterized protein LOC100640221 [Amphimedon queenslandica]	molecular function: binding (GO:0005488);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; biological process: single-organism process (GO:0044699);; molecular function: catalytic activity (GO:0003824)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN5493_c1_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	40.15	24.93	0.42	8.90	9.28	3.25	2.6711213947647e-05	12.3612505265799	up	2.36356531945547e-13	11.5948705337365	up	[O]	Posttranslational modification, protein turnover, chaperones 	Molecular Function: ATP binding (GO:0005524);; 	K03283|1.2e-273|lhu:105675460|K03283 heat shock 70kDa protein 1/2/6/8 | (RefSeq) LOW QUALITY PROTEIN: heat shock 70 kDa protein cognate 4	[O]	Posttranslational modification, protein turnover, chaperones 	Hsp70 protein;; MreB/Mbl protein;; Protein of unknown function (DUF3128)	Heat shock protein hsp-1 OS=Caenorhabditis elegans OX=6239 GN=hsp-1 PE=1 SV=2	O	Posttranslational modification, protein turnover, chaperones	heat shock protein cognate 70-1 [Laodelphax striatellus]	molecular function: binding (GO:0005488)	Spliceosome (ko03040);; Protein processing in endoplasmic reticulum (ko04141);; Endocytosis (ko04144);; Longevity regulating pathway - multiple species (ko04213)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN5517_c0_g1	LOC106118619	446.30	41.09	52.56	478.25	171.63	69.29	9.26	1.70	7.99	29.91	2.42	3.70	4.0079035203422e-06	-5.13797208486942	down	0.00427510497489263	-3.85088347340942	down	[O]	Posttranslational modification, protein turnover, chaperones 	Molecular Function: ATP binding (GO:0005524);; 	K03283|5.9e-295|tnl:113502431|K03283 heat shock 70kDa protein 1/2/6/8 | (RefSeq) heat shock protein 70 A1-like	[O]	Posttranslational modification, protein turnover, chaperones 	Hsp70 protein;; MreB/Mbl protein	Heat shock protein 68 OS=Drosophila melanogaster OX=7227 GN=Hsp68 PE=1 SV=1	O	Posttranslational modification, protein turnover, chaperones	PREDICTED: heat shock protein 68-like [Papilio xuthus]	molecular function: binding (GO:0005488)	Spliceosome (ko03040);; Protein processing in endoplasmic reticulum (ko04141);; Endocytosis (ko04144);; Longevity regulating pathway - multiple species (ko04213)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN55233_c0_g1	LOC108666905	0.00	0.00	0.00	0.00	0.00	0.00	64.99	42.23	3.81	47.28	36.54	11.86	2.90298736413603e-09	9.95404296742563	up	3.8920641561241e-11	10.6553664960405	up	[S]	Function unknown 	--	--	--	--	Domain of unknown function (DUF1993)	--	--	--	PREDICTED: uncharacterized protein LOC108666905 [Hyalella azteca]	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN55298_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	63.77	47.29	2.85	41.34	48.27	10.86	1.26399479333448e-09	10.3816937938858	up	1.20309611057052e-11	11.1014220552206	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: RNA binding (GO:0003723);; Molecular Function: structural constituent of ribosome (GO:0003735);; Biological Process: translation (GO:0006412);; Cellular Component: small ribosomal subunit (GO:0015935);; 	K02958|8.0e-61|lak:106155221|K02958 small subunit ribosomal protein S15e | (RefSeq) 40S ribosomal protein S15	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal protein S19	40S ribosomal protein S15 OS=Caenorhabditis elegans OX=6239 GN=rps-15 PE=1 SV=3	J	Translation, ribosomal structure and biogenesis	hypothetical protein [Phragmatopoma lapidosa]	molecular function: binding (GO:0005488);; molecular function: structural molecule activity (GO:0005198);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN5812_c0_g1	--	27.48	49.71	60.59	16.63	23.07	5.13	319.46	132.12	261.90	195.07	27.82	225.82	0.00198488394151209	2.09852693576575	up	0.00239883995645078	3.39982931176071	up	[O]	Posttranslational modification, protein turnover, chaperones 	Molecular Function: serine-type endopeptidase activity (GO:0004252);; Biological Process: proteolysis (GO:0006508);; 	K01312|4.0e-24|tnl:113500529|K01312 trypsin [EC:3.4.21.4] | (RefSeq) trypsin-like	[E]	Amino acid transport and metabolism 	Trypsin	Trypsin-2 OS=Anopheles gambiae OX=7165 GN=TRYP2 PE=2 SV=2	E	Amino acid transport and metabolism	unnamed protein product [Arctia plantaginis]	biological process: metabolic process (GO:0008152);; molecular function: catalytic activity (GO:0003824)	Neuroactive ligand-receptor interaction (ko04080)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN5919_c0_g1	LOC110856224	0.00	0.00	0.00	0.00	0.00	0.00	32.29	29.28	1.42	5.29	13.59	4.81	3.02939217110049e-13	12.3538475662702	up	1.41322363826429e-13	11.717239950299	up	[G]	Carbohydrate transport and metabolism 	Molecular Function: catalytic activity (GO:0003824);; 	--	--	--	Domain of unknown function (DUF5127);; Domain of unknown function (DUF4965);; Domain of unknown function (DUF1793)	--	S	Function unknown	glutaminase A [Folsomia candida]	molecular function: catalytic activity (GO:0003824)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN6204_c0_g1	TM35_000093280	0.00	0.00	0.00	0.00	0.00	0.00	15.41	17.28	1.16	5.04	7.93	2.39	7.95395469594053e-11	10.9389728573154	up	3.56267163877375e-11	10.5604123667142	up	--	--	Cellular Component: Golgi membrane (GO:0000139);; Molecular Function: molecular_function (GO:0003674);; Molecular Function: transporter activity (GO:0005215);; Molecular Function: nucleotide-sugar transmembrane transporter activity (GO:0005338);; Molecular Function: UDP-galactose transmembrane transporter activity (GO:0005459);; Molecular Function: UDP-N-acetylglucosamine transmembrane transporter activity (GO:0005462);; Molecular Function: UDP-N-acetylgalactosamine transmembrane transporter activity (GO:0005463);; Cellular Component: cellular_component (GO:0005575);; Cellular Component: intracellular (GO:0005622);; Cellular Component: obsolete cell (GO:0005623);; Cellular Component: nucleus (GO:0005634);; Cellular Component: cytoplasm (GO:0005737);; Cellular Component: endoplasmic reticulum (GO:0005783);; Cellular Component: Golgi apparatus (GO:0005794);; Cellular Component: Golgi stack (GO:0005795);; Cellular Component: Golgi medial cisterna (GO:0005797);; Biological Process: carbohydrate metabolic process (GO:0005975);; Biological Process: monosaccharide metabolic process (GO:0005996);; Biological Process: galactose metabolic process (GO:0006012);; Biological Process: transport (GO:0006810);; Biological Process: ion transport (GO:0006811);; Biological Process: anion transport (GO:0006820);; Biological Process: biological_process (GO:0008150);; Biological Process: metabolic process (GO:0008152);; Molecular Function: anion transmembrane transporter activity (GO:0008509);; Molecular Function: organic anion transmembrane transporter activity (GO:0008514);; Biological Process: carbohydrate transport (GO:0008643);; Biological Process: hexose transmembrane transport (GO:0008645);; Cellular Component: endomembrane system (GO:0012505);; Molecular Function: ion transmembrane transporter activity (GO:0015075);; Molecular Function: pyrimidine nucleotide-sugar transmembrane transporter activity (GO:0015165);; Biological Process: organic anion transport (GO:0015711);; Biological Process: monosaccharide transmembrane transport (GO:0015749);; Biological Process: galactose transmembrane transport (GO:0015757);; Biological Process: nucleotide-sugar transmembrane transport (GO:0015780);; Biological Process: UDP-N-acetylgalactosamine transmembrane transport (GO:0015789);; Biological Process: nucleobase-containing compound transport (GO:0015931);; Molecular Function: nucleobase-containing compound transmembrane transporter activity (GO:0015932);; Cellular Component: membrane (GO:0016020);; Cellular Component: integral component of membrane (GO:0016021);; Biological Process: hexose metabolic process (GO:0019318);; Molecular Function: transmembrane transporter activity (GO:0022857);; Cellular Component: integral component of Golgi membrane (GO:0030173);; Cellular Component: organelle membrane (GO:0031090);; Cellular Component: intrinsic component of membrane (GO:0031224);; Cellular Component: intrinsic component of Golgi membrane (GO:0031228);; Cellular Component: intrinsic component of organelle membrane (GO:0031300);; Cellular Component: integral component of organelle membrane (GO:0031301);; Cellular Component: organelle subcompartment (GO:0031984);; Cellular Component: Golgi cisterna (GO:0031985);; Biological Process: carbohydrate transmembrane transport (GO:0034219);; Biological Process: ion transmembrane transport (GO:0034220);; Cellular Component: organelle (GO:0043226);; Cellular Component: membrane-bounded organelle (GO:0043227);; Cellular Component: intracellular organelle (GO:0043229);; Cellular Component: intracellular membrane-bounded organelle (GO:0043231);; Biological Process: primary metabolic process (GO:0044238);; Biological Process: small molecule metabolic process (GO:0044281);; Cellular Component: obsolete organelle part (GO:0044422);; Cellular Component: obsolete intracellular part (GO:0044424);; Cellular Component: obsolete membrane part (GO:0044425);; Cellular Component: obsolete Golgi apparatus part (GO:0044431);; Cellular Component: obsolete cytoplasmic part (GO:0044444);; Cellular Component: obsolete intracellular organelle part (GO:0044446);; Cellular Component: obsolete cell part (GO:0044464);; Cellular Component: perinuclear region of cytoplasm (GO:0048471);; Biological Process: localization (GO:0051179);; Biological Process: establishment of localization (GO:0051234);; Biological Process: transmembrane transport (GO:0055085);; Biological Process: organic substance transport (GO:0071702);; Biological Process: organic substance metabolic process (GO:0071704);; Biological Process: nitrogen compound transport (GO:0071705);; Biological Process: UDP-galactose transmembrane transport (GO:0072334);; Biological Process: pyrimidine nucleotide-sugar transmembrane transport (GO:0090481);; Cellular Component: bounding membrane of organelle (GO:0098588);; Biological Process: anion transmembrane transport (GO:0098656);; Cellular Component: Golgi apparatus subcompartment (GO:0098791);; Biological Process: carbohydrate derivative transport (GO:1901264);; Molecular Function: carbohydrate derivative transmembrane transporter activity (GO:1901505);; Biological Process: UDP-N-acetylglucosamine transmembrane transport (GO:1990569);; 	K15272|2.4e-10|pbar:105428498|K15272 solute carrier family 35 (UDP-sugar transporter), member A1/2/3 | (RefSeq) CMP-sialic acid transporter 4	--	--	Nucleotide-sugar transporter	--	G	Carbohydrate transport and metabolism	UDP-galactose transporter [Trypanosoma theileri]	cellular component: cell (GO:0005623);; cellular component: membrane (GO:0016020);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464);; biological process: localization (GO:0051179);; molecular function: transporter activity (GO:0005215);; biological process: single-organism process (GO:0044699);; biological process: metabolic process (GO:0008152);; cellular component: membrane part (GO:0044425)	--	1	p3	(GCC)5	15	206	220	AATCTTTCGACTCCCAACCA	59.526	20	GACGGCGAGAAGGAGTAGG	59.958	19	265	38	302	CCGAGGAAAGGCTGAAATCT	60.703	20	GACGGCGAGAAGGAGTAGG	59.958	19	280	23	302	TCCCGAGTAGTCATCTTCCC	59.090	20	GACGGCGAGAAGGAGTAGG	59.958	19	234	69	302
TRINITY_DN6300_c0_g1	--	519.66	1294.12	276.43	52.74	1222.65	1184.58	7.25	17.28	18.07	28.06	20.67	41.88	3.1226630603301e-13	-5.79499591716593	down	5.90068041893429e-05	-4.72266760288395	down	--	--	Molecular Function: structural constituent of cuticle (GO:0042302);; 	--	--	--	Insect cuticle protein	Larval cuticle protein LCP-22 OS=Bombyx mori OX=7091 GN=LCP22 PE=2 SV=1	--	--	PREDICTED: larval cuticle protein LCP-17-like [Plutella xylostella]	molecular function: structural molecule activity (GO:0005198)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN6319_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	29.93	18.87	1.10	12.96	13.10	4.02	1.76756999231058e-11	11.4667758445735	up	4.49875253888316e-13	11.5937892456431	up	[G]	Carbohydrate transport and metabolism 	Molecular Function: molecular_function (GO:0003674);; Molecular Function: transporter activity (GO:0005215);; Molecular Function: organic acid transmembrane transporter activity (GO:0005342);; Cellular Component: cellular_component (GO:0005575);; Biological Process: cellular aromatic compound metabolic process (GO:0006725);; Biological Process: eye pigment biosynthetic process (GO:0006726);; Biological Process: ommochrome biosynthetic process (GO:0006727);; Biological Process: transport (GO:0006810);; Biological Process: ion transport (GO:0006811);; Biological Process: anion transport (GO:0006820);; Molecular Function: monocarboxylic acid transmembrane transporter activity (GO:0008028);; Biological Process: ocellus pigment biosynthetic process (GO:0008055);; Biological Process: biological_process (GO:0008150);; Biological Process: metabolic process (GO:0008152);; Molecular Function: anion transmembrane transporter activity (GO:0008509);; Molecular Function: organic anion transmembrane transporter activity (GO:0008514);; Biological Process: biosynthetic process (GO:0009058);; Biological Process: cellular process (GO:0009987);; Molecular Function: ion transmembrane transporter activity (GO:0015075);; Molecular Function: inorganic molecular entity transmembrane transporter activity (GO:0015318);; Biological Process: organic anion transport (GO:0015711);; Biological Process: monocarboxylic acid transport (GO:0015718);; Biological Process: organic acid transport (GO:0015849);; Cellular Component: membrane (GO:0016020);; Cellular Component: integral component of membrane (GO:0016021);; Biological Process: heterocycle biosynthetic process (GO:0018130);; Biological Process: aromatic compound biosynthetic process (GO:0019438);; Biological Process: secondary metabolic process (GO:0019748);; Molecular Function: transmembrane transporter activity (GO:0022857);; Cellular Component: intrinsic component of membrane (GO:0031224);; Biological Process: ocellus pigmentation (GO:0033060);; Biological Process: ion transmembrane transport (GO:0034220);; Biological Process: pigment metabolic process (GO:0042440);; Biological Process: eye pigment metabolic process (GO:0042441);; Biological Process: pigment metabolic process involved in developmental pigmentation (GO:0043324);; Biological Process: pigmentation (GO:0043473);; Biological Process: pigment metabolic process involved in pigmentation (GO:0043474);; Biological Process: cellular metabolic process (GO:0044237);; Biological Process: cellular biosynthetic process (GO:0044249);; Cellular Component: obsolete membrane part (GO:0044425);; Biological Process: secondary metabolite biosynthetic process (GO:0044550);; Biological Process: pigment biosynthetic process (GO:0046148);; Biological Process: ommochrome metabolic process (GO:0046152);; Biological Process: ocellus pigment metabolic process (GO:0046158);; Biological Process: heterocycle metabolic process (GO:0046483);; Biological Process: carboxylic acid transport (GO:0046942);; Molecular Function: carboxylic acid transmembrane transporter activity (GO:0046943);; Biological Process: developmental pigmentation (GO:0048066);; Biological Process: eye pigmentation (GO:0048069);; Biological Process: localization (GO:0051179);; Biological Process: establishment of localization (GO:0051234);; Biological Process: transmembrane transport (GO:0055085);; Biological Process: organic substance transport (GO:0071702);; Biological Process: organic substance metabolic process (GO:0071704);; Biological Process: anion transmembrane transport (GO:0098656);; Biological Process: organic cyclic compound metabolic process (GO:1901360);; Biological Process: organic cyclic compound biosynthetic process (GO:1901362);; Biological Process: organic substance biosynthetic process (GO:1901576);; Biological Process: organic acid transmembrane transport (GO:1903825);; Biological Process: carboxylic acid transmembrane transport (GO:1905039);; 	K08187|1.4e-16|mdl:103575271|K08187 MFS transporter, MCT family, solute carrier family 16 (monocarboxylic acid transporters), member 10 | (RefSeq) monocarboxylate transporter 10	[G]	Carbohydrate transport and metabolism 	Major Facilitator Superfamily;; Sugar (and other) transporter	--	G	Carbohydrate transport and metabolism	slc16a-11, partial [Schmidtea mediterranea]	biological process: localization (GO:0051179);; molecular function: transporter activity (GO:0005215);; biological process: single-organism process (GO:0044699);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN6414_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	38.41	20.59	1.40	18.67	16.92	4.25	1.30620036143828e-09	10.4150585047605	up	5.16401623317892e-11	10.7234710966612	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN648_c0_g4	--	0.00	0.00	0.00	0.00	0.00	0.00	29.78	8.82	0.73	6.89	10.82	2.72	1.00468237992209e-09	10.6772476124505	up	3.56815219125041e-11	10.6924234854196	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN6555_c0_g1	--	0.00	0.03	0.00	0.00	0.10	0.00	30.16	18.31	1.15	53.71	13.79	4.17	1.4198075600427e-08	9.63191192810379	up	4.77222704907932e-09	9.04551285849789	up	--	--	Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553);; Biological Process: carbohydrate metabolic process (GO:0005975);; 	--	--	--	Glycosyl hydrolases family 17	--	--	--	--	molecular function: catalytic activity (GO:0003824);; biological process: metabolic process (GO:0008152)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN6905_c0_g1	SAMD00019534_053760	0.00	0.00	0.00	0.00	0.00	0.00	11.45	3.55	0.62	7.19	5.89	1.57	9.21555603351206e-09	9.70020701852848	up	1.68533175009094e-10	10.2847913375743	up	[C]	Energy production and conversion 	Molecular Function: oxidoreductase activity (GO:0016491);; Molecular Function: flavin adenine dinucleotide binding (GO:0050660);; Biological Process: oxidation-reduction process (GO:0055114);; Molecular Function: FAD binding (GO:0071949);; 	--	--	--	FAD binding domain	--	O	Posttranslational modification, protein turnover, chaperones	hypothetical protein SAMD00019534_053760 [Acytostelium subglobosum LB1]	biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699);; molecular function: catalytic activity (GO:0003824);; molecular function: binding (GO:0005488)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN7224_c0_g2	NECAME_04258	0.14	0.04	0.00	0.00	0.00	0.00	124.55	159.57	4.51	57.60	61.17	17.69	1.25250122821621e-14	10.4808574912162	up	2.09299034252997e-16	13.1784029601122	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: translation elongation factor activity (GO:0003746);; Molecular Function: GTPase activity (GO:0003924);; Molecular Function: GTP binding (GO:0005525);; 	K03231|1.1e-225|xla:108704161|K03231 elongation factor 1-alpha | (RefSeq) elongation factor 1-alpha, somatic form	[J]	Translation, ribosomal structure and biogenesis 	Elongation factor Tu GTP binding domain;; Elongation factor Tu C-terminal domain;; Elongation factor Tu domain 2	Elongation factor 1-alpha OS=Caenorhabditis elegans OX=6239 GN=eft-3 PE=3 SV=1	J	Translation, ribosomal structure and biogenesis	translation elongation factor EF-1, subunit alpha [Necator americanus]	biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; molecular function: binding (GO:0005488);; molecular function: catalytic activity (GO:0003824)	RNA transport (ko03013)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN7266_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	62.08	43.57	2.11	20.68	21.41	7.33	9.39404699544053e-10	10.6017800307515	up	6.60274209804015e-11	10.3491958415469	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN7270_c0_g1	--	0.00	0.00	0.00	0.98	0.79	0.00	58.05	68.03	219.34	26.93	22.88	94.46	4.71154190780529e-09	9.46060234591319	up	2.89256534191917e-07	6.88836109202185	up	--	--	Cellular Component: extracellular region (GO:0005576);; Biological Process: antibacterial humoral response (GO:0019731);; 	--	--	--	Cecropin family	--	--	--	--	cellular component: extracellular region (GO:0005576);; biological process: immune system process (GO:0002376);; biological process: response to stimulus (GO:0050896);; biological process: multi-organism process (GO:0051704)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN7283_c0_g1	--	3.71	1.54	0.00	30.53	22.34	14.96	1618.23	836.13	2119.73	230.76	146.98	936.92	2.71170396013235e-20	8.90435240084173	up	3.63216469162175e-07	4.0140256084817	up	--	--	Cellular Component: extracellular region (GO:0005576);; Biological Process: antibacterial humoral response (GO:0019731);; 	--	--	--	--	--	--	--	--	cellular component: extracellular region (GO:0005576);; biological process: immune system process (GO:0002376);; biological process: response to stimulus (GO:0050896);; biological process: multi-organism process (GO:0051704)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN7283_c2_g1	--	0.00	0.00	0.00	0.00	0.00	0.23	23.32	4.77	11.93	2.54	5.36	9.13	1.09146951803309e-08	8.89475132959467	up	1.98278776619872e-06	6.47691568943263	up	--	--	Cellular Component: extracellular region (GO:0005576);; Biological Process: antibacterial humoral response (GO:0019731);; 	--	--	--	--	--	--	--	--	cellular component: extracellular region (GO:0005576);; biological process: immune system process (GO:0002376);; biological process: response to stimulus (GO:0050896);; biological process: multi-organism process (GO:0051704)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN7287_c0_g1	H696_01398	0.00	0.00	0.00	0.00	0.00	0.00	24.03	85.40	4.76	3.44	44.99	13.70	3.1226630603301e-13	12.4201896879118	up	3.54923069743924e-12	12.1644959344137	up	[G]	Carbohydrate transport and metabolism 	Cellular Component: integral component of membrane (GO:0016021);; Molecular Function: transmembrane transporter activity (GO:0022857);; 	--	[R]	General function prediction only 	Major Facilitator Superfamily;; Sugar (and other) transporter	--	--	--	hypothetical protein H696_01398 [Fonticula alba]	cellular component: membrane (GO:0016020);; cellular component: membrane part (GO:0044425);; biological process: localization (GO:0051179);; molecular function: transporter activity (GO:0005215)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN7392_c0_g2	LOC100640221	0.00	0.00	0.00	0.00	0.00	0.00	20.31	6.95	0.99	11.15	11.93	3.45	2.74596548217089e-10	10.6089088499464	up	1.0304847325592e-12	11.4451390165749	up	[Q]	Secondary metabolites biosynthesis, transport and catabolism 	Molecular Function: catalytic activity (GO:0003824);; Molecular Function: iron ion binding (GO:0005506);; Biological Process: cellular aromatic compound metabolic process (GO:0006725);; Molecular Function: ferric iron binding (GO:0008199);; Biological Process: catechol-containing compound metabolic process (GO:0009712);; Molecular Function: catechol 1,2-dioxygenase activity (GO:0018576);; Biological Process: oxidation-reduction process (GO:0055114);; Molecular Function: FAD binding (GO:0071949);; 	--	--	--	FAD binding domain;; NAD(P)-binding Rossmann-like domain;; FAD dependent oxidoreductase;; Dioxygenase;; Catechol dioxygenase N terminus	--	E	Amino acid transport and metabolism	PREDICTED: uncharacterized protein LOC100640221 [Amphimedon queenslandica]	molecular function: catalytic activity (GO:0003824);; molecular function: binding (GO:0005488);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; biological process: single-organism process (GO:0044699)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN7489_c0_g1	H696_04988	0.00	0.00	0.00	0.00	0.00	0.00	37.32	16.51	0.94	9.88	12.68	3.24	6.23720964640542e-10	10.7680200814385	up	5.05096790575208e-11	10.6009185302833	up	--	--	Molecular Function: G protein-coupled receptor binding (GO:0001664);; Molecular Function: GTPase activity (GO:0003924);; Molecular Function: GTP binding (GO:0005525);; Cellular Component: heterotrimeric G-protein complex (GO:0005834);; Biological Process: G protein-coupled receptor signaling pathway (GO:0007186);; Molecular Function: G-protein beta/gamma-subunit complex binding (GO:0031683);; 	K04630|6.8e-60|obi:106874528|K04630 guanine nucleotide-binding protein G(i) subunit alpha | (RefSeq) guanine nucleotide-binding protein G(i) subunit alpha-like	[DT]	--	G-protein alpha subunit;; ADP-ribosylation factor family;; G-protein alpha subunit	Guanine nucleotide-binding protein G(i) subunit alpha OS=Planorbella trivolvis OX=283763 PE=2 SV=2	--	--	guanine nucleotide-binding protein subunit alpha, other [Fonticula alba]	molecular function: binding (GO:0005488);; molecular function: catalytic activity (GO:0003824);; cellular component: cell (GO:0005623);; cellular component: membrane (GO:0016020);; cellular component: macromolecular complex (GO:0032991);; cellular component: membrane part (GO:0044425);; cellular component: cell part (GO:0044464);; biological process: cellular process (GO:0009987);; biological process: signaling (GO:0023052);; biological process: single-organism process (GO:0044699);; biological process: response to stimulus (GO:0050896);; biological process: biological regulation (GO:0065007)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN7619_c0_g1	LOC114334911	0.00	0.00	0.00	0.00	0.00	0.00	71.62	76.86	1.77	33.41	27.64	11.38	5.54511867512692e-06	12.4509072590407	up	1.23289936243511e-14	12.1708268874381	up	[G]	Carbohydrate transport and metabolism 	Biological Process: carbohydrate metabolic process (GO:0005975);; Molecular Function: chitin binding (GO:0008061);; 	K01183|3.5e-16|cqu:CpipJ_CPIJ000009|K01183 chitinase [EC:3.2.1.14] | (RefSeq) chitinase A1	[G]	Carbohydrate transport and metabolism 	Glycosyl hydrolases family 18	--	G	Carbohydrate transport and metabolism	chitotriosidase-1-like [Diabrotica virgifera virgifera]	biological process: metabolic process (GO:0008152);; molecular function: binding (GO:0005488)	Amino sugar and nucleotide sugar metabolism (ko00520)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN7633_c0_g1	LOC113823851	0.00	0.00	0.03	0.13	0.09	0.00	483.21	204.83	6.78	49.05	107.56	41.27	7.38509751409286e-16	13.9333255682039	up	1.0190421717591e-22	10.2899998516586	up	--	--	--	--	--	--	Peptidase M60, enhancin and enhancin-like;; N-terminal domain of M60-like peptidases	--	--	--	uncharacterized protein LOC113823851 isoform X1 [Penaeus vannamei]	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN7762_c0_g1	LOC110440726	0.00	0.00	0.00	0.00	0.00	0.00	43.52	29.38	2.07	20.40	26.26	5.99	9.77099116297404e-10	10.4179850394799	up	3.52453058507662e-11	10.7855378024148	up	[J]	Translation, ribosomal structure and biogenesis 	Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: ribosome (GO:0005840);; Biological Process: translation (GO:0006412);; Molecular Function: rRNA binding (GO:0019843);; 	K02987|1.0e-111|myi:110440726|K02987 small subunit ribosomal protein S4e | (RefSeq) 40S ribosomal protein S4-like	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal family S4e;; 40S ribosomal protein S4 C-terminus;; RS4NT (NUC023) domain;; KOW motif;; S4 domain	40S ribosomal protein S4 OS=Ixodes scapularis OX=6945 GN=RpS4 PE=2 SV=1	J	Translation, ribosomal structure and biogenesis	40S ribosomal protein S4-like, partial [Mizuhopecten yessoensis]	molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: cell part (GO:0044464);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; molecular function: binding (GO:0005488)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN7798_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	2271.47	103.44	43.30	1342.65	413.42	43.31	9.37833674759044e-06	13.2442823117254	up	4.1007327616679e-14	14.0037165501736	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN796_c0_g1	LOC114527559	0.00	0.00	0.00	0.00	0.00	0.00	24.59	17.77	1.57	9.18	14.36	2.94	7.46379531827487e-09	9.73748835461637	up	1.60617701557201e-09	9.93531707005349	up	--	--	Biological Process: maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000463);; Molecular Function: structural constituent of ribosome (GO:0003735);; Cellular Component: cytosolic large ribosomal subunit (GO:0022625);; 	K02937|4.2e-82|epa:110236162|K02937 large subunit ribosomal protein L7e | (RefSeq) 60S ribosomal protein L7	[J]	Translation, ribosomal structure and biogenesis 	Ribosomal L30 N-terminal domain;; Ribosomal protein L30p/L7e	60S ribosomal protein L7 OS=Caenorhabditis elegans OX=6239 GN=rpl-7 PE=3 SV=1	J	Translation, ribosomal structure and biogenesis	60S ribosomal protein L7-like [Dendronephthya gigantea]	biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; biological process: cellular component organization or biogenesis (GO:0071840);; molecular function: structural molecule activity (GO:0005198);; cellular component: cell (GO:0005623);; cellular component: macromolecular complex (GO:0032991);; cellular component: organelle (GO:0043226);; cellular component: organelle part (GO:0044422);; cellular component: cell part (GO:0044464)	Ribosome (ko03010)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN8490_c0_g1	AMSG_03723	0.00	0.00	0.00	0.00	0.00	0.00	63.76	25.11	0.60	14.10	17.31	6.52	5.55590805258224e-05	11.9648610031162	up	1.19224145218671e-13	11.6299909795724	up	[P]	Inorganic ion transport and metabolism 	--	K00485|3.2e-06|sbq:101042967|K00485 dimethylaniline monooxygenase (N-oxide forming) [EC:1.14.13.8] | (RefSeq) FMO2; dimethylaniline monooxygenase [N-oxide-forming] 2 isoform X1	--	--	Pyridine nucleotide-disulphide oxidoreductase;; Pyridine nucleotide-disulphide oxidoreductase;; L-lysine 6-monooxygenase (NADPH-requiring);; Flavin-binding monooxygenase-like	--	Q	Secondary metabolites biosynthesis, transport and catabolism	JerO protein [Thecamonas trahens ATCC 50062]	--	Drug metabolism - cytochrome P450 (ko00982)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN8560_c0_g1	LOC110994286	0.06	0.00	0.32	1.64	0.18	0.00	218.67	149.01	284.82	18.77	0.65	53.43	2.09389787237441e-34	12.0072223519823	up	0.000777803328510655	5.94740453691302	up	[E]	Amino acid transport and metabolism 	Molecular Function: L-threonine ammonia-lyase activity (GO:0004794);; Biological Process: threonine catabolic process (GO:0006567);; 	K01754|2.2e-139|prap:110994286|K01754 threonine dehydratase [EC:4.3.1.19] | (RefSeq) uncharacterized protein LOC110994286 isoform X1	[E]	Amino acid transport and metabolism 	Pyridoxal-phosphate dependent enzyme	Probable serine racemase OS=Dictyostelium discoideum OX=44689 GN=srr PE=3 SV=1	E	Amino acid transport and metabolism	uncharacterized protein LOC110994286 isoform X1 [Pieris rapae]	molecular function: catalytic activity (GO:0003824);; biological process: metabolic process (GO:0008152);; biological process: cellular process (GO:0009987);; biological process: single-organism process (GO:0044699)	Glycine, serine and threonine metabolism (ko00260);; Valine, leucine and isoleucine biosynthesis (ko00290);; Carbon metabolism (ko01200);; Biosynthesis of amino acids (ko01230)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN869_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	163.93	52.31	1.59	3.26	14.33	12.00	3.57596559604557e-05	12.1338298979006	up	1.40970626535891e-10	10.058433255695	up	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN9112_c0_g1	--	0.00	0.00	0.00	0.00	0.00	0.00	17.16	8.32	2.36	8.52	15.32	3.50	3.8839645705757e-07	8.10276944311486	up	4.6510273355478e-09	9.14405879650755	up	[I]	Lipid transport and metabolism 	--	--	--	--	Alpha/beta hydrolase family;; Serine aminopeptidase, S33;; alpha/beta hydrolase fold;; Alpha/beta hydrolase of unknown function (DUF1057)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--
TRINITY_DN9617_c0_g2	LOC110847125	0.00	0.00	0.00	0.00	0.00	0.00	29.95	17.09	1.71	3.01	6.93	6.80	8.61473235871423e-12	11.2990371984015	up	2.73855716564163e-12	10.4574416760003	up	[Q]	Secondary metabolites biosynthesis, transport and catabolism 	Molecular Function: copper ion binding (GO:0005507);; Molecular Function: primary amine oxidase activity (GO:0008131);; Biological Process: amine metabolic process (GO:0009308);; Molecular Function: quinone binding (GO:0048038);; 	K00276|2.6e-102|fcd:110847125|K00276 primary-amine oxidase [EC:1.4.3.21] | (RefSeq) copper amine oxidase 1-like isoform X1	[Q]	Secondary metabolites biosynthesis, transport and catabolism 	Copper amine oxidase, enzyme domain;; Copper amine oxidase, N3 domain;; Copper amine oxidase, N2 domain	--	Q	Secondary metabolites biosynthesis, transport and catabolism	copper amine oxidase 1 [Folsomia candida]	molecular function: binding (GO:0005488);; biological process: metabolic process (GO:0008152);; biological process: single-organism process (GO:0044699);; molecular function: catalytic activity (GO:0003824)	Glycine, serine and threonine metabolism (ko00260);; Tyrosine metabolism (ko00350);; Phenylalanine metabolism (ko00360);; beta-Alanine metabolism (ko00410)	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--	--